SmProt

Specific Information of Small Protein : SPROHSA81311

General Information

Small Protein ID	SPROHSA81311
Organism	Human (Homo sapiens)
Small Protein Sequence	RRLRISWALSGPTRLPPPPTAL*
RNA Sequence	AGGCGTCTGAGGATCTCCTGGGCTCTCAGCGGCCCGACCCGCCTTCCCCCACCTCCCACAGCTCTGTAG
Protein Length	22
Start Codon	AGG
Location	chr19:43934945-43935014:-
Blocks	43934945-43935014
Mean PhyloCSF	-7.67447824064
Data Source	Ribosome profiling;
Related Genes	ENSG00000124459; ZNF45;
Mass (Da)	mono. 2454.4; avg. 2455.9

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR964946_alt	ENSG00000124459.12	ENST00000269973.10	ZNF45	Protein_coding	5'UTR	0.033802	0.007775	268	337	NA	NA

Min Ribo P value	0.033802
Min TIS P value	0.007775

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
SRR964946_alt	HEK293	WT	SRR964946	22927429;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
19-43934947-T-G	Stop Loss p.*23S	rs365769	SRR2818791; SRR2991181; SRR1795425; SRR1795426; SRR1795427

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results