Specific Information of Small Protein : SPROHSA61601
General Information
Small Protein ID | SPROHSA61601 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | TFRTATLKVKTDECTIGRQDSTP* |
RNA Sequence | ACGTTCAGAACGGCAACTCTTAAGGTTAAAACAGATGAATGTACAATTGGCCGCCAAGATTCAACACCTTGA |
Protein Length | 23 |
Start Codon | ACG |
Location | chr12:110650186-110650258:- |
Blocks | 110650186-110650258 |
Mean PhyloCSF | -7.15320831537 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000122986; HVCN1; |
Mass (Da) | mono. 2567.3; avg. 2568.9 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE94613_1_alt | ENSG00000122986.13 | ENST00000356742.9 | HVCN1 | Protein_coding | Internal | 0.031066 | None | 1419 | 1491 | 10 | 80.2283826 |
GSE94613_1_alt | ENSG00000122986.13 | ENST00000620084.4 | HVCN1 | Protein_coding | Internal | 0.031066 | None | 687 | 759 | 10 | 80.2283826 |
GSE94613_1_alt | ENSG00000122986.13 | ENST00000439744.6 | HVCN1 | Protein_coding | Internal | 0.031066 | None | 781 | 853 | 10 | 80.2283826 |
GSE94613_1_alt | ENSG00000122986.13 | ENST00000242607.12 | HVCN1 | Protein_coding | Internal | 0.031066 | None | 846 | 918 | 10 | 80.2283826 |
GSE94613_1_alt | ENSG00000122986.13 | ENST00000548312.5 | HVCN1 | Protein_coding | Internal | 0.031066 | None | 874 | 946 | 10 | 80.2283826 |
Min Ribo P value | 0.031066 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_1_alt | MOLM13 | Acute myeloid leukemia | GSM2481052 | 29186125; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
12-110650222-C-G | Non-Synonymous p.E13Q | . | SRR5239057 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |