Specific Information of Small Protein : SPROHSA333175
General Information
Small Protein ID | SPROHSA333175 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | VPSICQSTTLQRTGVPERPHPCHSRISHQH* |
RNA Sequence | GTGCCGAGCATATGCCAAAGCACTACACTACAAAGAACTGGAGTTCCAGAAAGGCCCCACCCCTGCCATTCTAGAATCTCTCATCAGCATTAA |
Protein Length | 30 |
Start Codon | GTG |
Location | chr1:11167511-11199344:- |
Blocks | 11167511-11167517,11199257-11199344 |
Mean PhyloCSF | 6.90978491947 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000198793; MTOR; ENSG00000171819; ANGPTL7; |
Mass (Da) | mono. 3387.7; avg. 3389.8 |
Ribosome profiling
Min Ribo P value | 0.034639 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
SRR5350740_alt | MCF7 | Breast adenocarcinoma | GSM2538884 | 28388414; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |