Specific Information of Small Protein : SPROHSA246172
General Information
Small Protein ID | SPROHSA246172 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | ISERAGASVPLRRHWEPDGKLR* |
RNA Sequence | ATTTCCGAGAGAGCGGGAGCGTCTGTACCTCTGCGGCGTCACTGGGAGCCCGACGGAAAACTGCGCTAA |
Protein Length | 22 |
Start Codon | ATT |
Location | chr22:45413701-45413770:+ |
Blocks | 45413701-45413770 |
Mean PhyloCSF | -6.47069563036 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000128408; RIBC2; |
Mass (Da) | mono. 2529.4; avg. 2530.8 |
Ribosome profiling
Min Ribo P value | 0.048078 |
Min TIS P value | 0.012769 |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE58207_alt | HCT116 | Colorectal carcinoma | GSM1403307; GSM1403308 | 25510491; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
22-45413743-C-A | Non-Synonymous p.H14Q | rs2272804 | SRR5350740; SRR5350745; SRR1795425; SRR1795427; SRR618771; SRR618773 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |