SmProt

Specific Information of Small Protein : SPROHSA233035

General Information

Small Protein ID	SPROHSA233035
Organism	Human (Homo sapiens)
Small Protein Sequence	IPPFLQRPTRGTGCERRATCECAQGLWTPAAAS*
RNA Sequence	ATTCCGCCTTTTCTTCAGCGTCCTACCCGCGGCACTGGCTGCGAGCGCCGGGCCACCTGCGAGTGTGCGCAGGGACTCTGGACACCCGCGGCGGCGAGCTGA
Protein Length	33
Start Codon	ATT
Location	chr5:50441193-50441295:-
Blocks	50441193-50441295
Mean PhyloCSF	-7.39891181974
Data Source	Ribosome profiling;
Related Genes	ENSG00000170571; EMB; NONHSAG092016;
Mass (Da)	mono. 3543.7; avg. 3546

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE94613_1_alt	ENSG00000170571.12	ENST00000508934.5	EMB	Protein_coding	5'UTR	0.047118	None	55	157	14	79.2845192

Min Ribo P value	0.047118
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE94613_1_alt	MOLM13	Acute myeloid leukemia	GSM2481052	29186125;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
5-50441293-A-C	Non-Synonymous p.I1M	rs28528780	SRR1795427

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results