Specific Information of Small Protein : SPROHSA219518
General Information
| Small Protein ID | SPROHSA219518 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MWSESYTVAEWGVLILSNKQHIFNIQD* |
| RNA Sequence | ATGTGGAGTGAAAGTTACACCGTGGCGGAATGGGGTGTATTGATTCTGAGCAATAAACAACATATTTTTAACATTCAGGATTGA |
| Protein Length | 27 |
| Start Codon | ATG |
| Location | chr19:52635147-52638338:- |
| Blocks | 52635147-52635204,52638311-52638338 |
| Mean PhyloCSF | -7.35463095847 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000167766; ZNF83; |
| Mass (Da) | mono. 3207.6; avg. 3209.6 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE103308 | ENSG00000167766.18 | ENST00000545872.1 | ZNF83 | Protein_coding | 5'UTR | 0.034381 | None | 47 | 131 | 5 | 5.29472100 |
| GSE103308_alt | ENSG00000167766.18 | ENST00000545872.1 | ZNF83 | Protein_coding | 5'UTR | 0.034381 | None | 47 | 131 | 5 | 5.29472100 |
| SRR618770,618771,618772,618773_alt | ENSG00000167766.18 | ENST00000545872.1 | ZNF83 | Protein_coding | 5'UTR | 0.010612 | 6.304E-05 | 47 | 131 | 7 | 14.0681166 |
| SRR964946_alt | ENSG00000167766.18 | ENST00000545872.1 | ZNF83 | Protein_coding | 5'UTR | 0.034381 | 0.001996 | 47 | 131 | NA | NA |
| Min Ribo P value | 0.010612 |
| Min TIS P value | 6.304E-05 |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE103308 | RD-muscle | WT | GSM2760247 | 29696588; |
| GSE103308_alt | RD-muscle | WT | GSM2760247 | 29696588; |
| SRR618770,618771,618772,618773_alt | HEK293 | WT | SRR618770; SRR618771; SRR618772; SRR618773 | NA; |
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| No results |
SmProt