Specific Information of Small Protein : SPROHSA219518
General Information
Small Protein ID | SPROHSA219518 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MWSESYTVAEWGVLILSNKQHIFNIQD* |
RNA Sequence | ATGTGGAGTGAAAGTTACACCGTGGCGGAATGGGGTGTATTGATTCTGAGCAATAAACAACATATTTTTAACATTCAGGATTGA |
Protein Length | 27 |
Start Codon | ATG |
Location | chr19:52635147-52638338:- |
Blocks | 52635147-52635204,52638311-52638338 |
Mean PhyloCSF | -7.35463095847 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000167766; ZNF83; |
Mass (Da) | mono. 3207.6; avg. 3209.6 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE103308 | ENSG00000167766.18 | ENST00000545872.1 | ZNF83 | Protein_coding | 5'UTR | 0.034381 | None | 47 | 131 | 5 | 5.29472100 |
GSE103308_alt | ENSG00000167766.18 | ENST00000545872.1 | ZNF83 | Protein_coding | 5'UTR | 0.034381 | None | 47 | 131 | 5 | 5.29472100 |
SRR618770,618771,618772,618773_alt | ENSG00000167766.18 | ENST00000545872.1 | ZNF83 | Protein_coding | 5'UTR | 0.010612 | 6.304E-05 | 47 | 131 | 7 | 14.0681166 |
SRR964946_alt | ENSG00000167766.18 | ENST00000545872.1 | ZNF83 | Protein_coding | 5'UTR | 0.034381 | 0.001996 | 47 | 131 | NA | NA |
Min Ribo P value | 0.010612 |
Min TIS P value | 6.304E-05 |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE103308 | RD-muscle | WT | GSM2760247 | 29696588; |
GSE103308_alt | RD-muscle | WT | GSM2760247 | 29696588; |
SRR618770,618771,618772,618773_alt | HEK293 | WT | SRR618770; SRR618771; SRR618772; SRR618773 | NA; |
SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |