SmProt

Specific Information of Small Protein : SPROHSA206636

General Information

Small Protein ID	SPROHSA206636
Organism	Human (Homo sapiens)
Small Protein Sequence	MGAIVRRL*
RNA Sequence	ATGGGTGCTATTGTGAGGCGGTTGTAG
Protein Length	8
Start Codon	ATG
Location	chr4:184649397-184649424:-
Blocks	184649397-184649424
Mean PhyloCSF	-8.11011120125
Data Source	Ribosome profiling; Literature;
Related Genes	ENSG00000164305; CASP3;
Mass (Da)	mono. 914.5; avg. 915.2

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR4045276	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.007179	None	23	50	13	114.034580
SRR4045276_alt	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.007179	None	23	50	13	114.034580
GSE45833_4	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.00751	None	23	50	58	464.128385
GSE45833_4_alt	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.00751	None	23	50	58	464.128385
SRR4045276	ENSG00000164305.19	ENST00000447121.2	CASP3	Protein_coding	5'UTR	0.007179	None	23	50	13	114.034580
SRR4045276_alt	ENSG00000164305.19	ENST00000447121.2	CASP3	Protein_coding	5'UTR	0.007179	None	23	50	13	114.034580
GSE45833_4	ENSG00000164305.19	ENST00000447121.2	CASP3	Protein_coding	5'UTR	0.00751	None	23	50	58	464.128385
GSE45833_4_alt	ENSG00000164305.19	ENST00000447121.2	CASP3	Protein_coding	5'UTR	0.00751	None	23	50	58	464.128385
SRR4045276	ENSG00000164305.19	ENST00000517513.5	CASP3	Protein_coding	5'UTR	0.007179	None	23	50	13	114.034580
SRR4045276_alt	ENSG00000164305.19	ENST00000517513.5	CASP3	Protein_coding	5'UTR	0.007179	None	23	50	13	114.034580
GSE45833_4	ENSG00000164305.19	ENST00000517513.5	CASP3	Protein_coding	5'UTR	0.00751	None	23	50	58	464.128385
GSE45833_4_alt	ENSG00000164305.19	ENST00000517513.5	CASP3	Protein_coding	5'UTR	0.00751	None	23	50	58	464.128385
GSE103308	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.021221	None	23	50	123	405.222647
GSE103308	ENSG00000164305.19	ENST00000447121.2	CASP3	Protein_coding	5'UTR	0.021221	None	23	50	123	405.222647
GSE103308	ENSG00000164305.19	ENST00000517513.5	CASP3	Protein_coding	5'UTR	0.021221	None	23	50	123	405.222647
GSE103308_alt	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.021221	None	23	50	123	405.222647
GSE103308_alt	ENSG00000164305.19	ENST00000447121.2	CASP3	Protein_coding	5'UTR	0.021221	None	23	50	123	405.222647
GSE103308_alt	ENSG00000164305.19	ENST00000517513.5	CASP3	Protein_coding	5'UTR	0.021221	None	23	50	123	405.222647
GSE58207_alt	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.009683	0.044016	23	50	106	404.317434
SRR618770,618771,618772,618773_alt	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.014355	9.522E-17	23	50	50	312.624815
SRR618770,618771,618772,618773_alt	ENSG00000164305.19	ENST00000447121.2	CASP3	Protein_coding	5'UTR	0.014355	2.776E-09	23	50	50	312.624815
SRR618770,618771,618772,618773_alt	ENSG00000164305.19	ENST00000517513.5	CASP3	Protein_coding	5'UTR	0.014355	2.776E-09	23	50	50	312.624815
SRR964946_alt	ENSG00000164305.19	ENST00000308394.9	CASP3	Protein_coding	5'UTR	0.011047	0.012865	23	50	NA	NA
SRR964946_alt	ENSG00000164305.19	ENST00000447121.2	CASP3	Protein_coding	5'UTR	0.011047	0.046275	23	50	NA	NA
SRR964946_alt	ENSG00000164305.19	ENST00000517513.5	CASP3	Protein_coding	5'UTR	0.011047	0.026586	23	50	NA	NA
SRR4045276	ENSG00000164305.19	ENST00000393588.8	CASP3	Protein_coding	5'UTR	0.007179	None	31	58	13	114.034580
SRR4045276_alt	ENSG00000164305.19	ENST00000393588.8	CASP3	Protein_coding	5'UTR	0.007179	None	31	58	13	114.034580
GSE45833_4	ENSG00000164305.19	ENST00000393588.8	CASP3	Protein_coding	5'UTR	0.00751	None	31	58	58	464.128385
GSE45833_4_alt	ENSG00000164305.19	ENST00000393588.8	CASP3	Protein_coding	5'UTR	0.00751	None	31	58	58	464.128385
GSE103308	ENSG00000164305.19	ENST00000393588.8	CASP3	Protein_coding	5'UTR	0.021221	None	31	58	123	405.222647
GSE103308_alt	ENSG00000164305.19	ENST00000393588.8	CASP3	Protein_coding	5'UTR	0.021221	None	31	58	123	405.222647
SRR618770,618771,618772,618773_alt	ENSG00000164305.19	ENST00000393588.8	CASP3	Protein_coding	5'UTR	0.036684	2.776E-09	31	58	49	306.372319
SRR964946_alt	ENSG00000164305.19	ENST00000393588.8	CASP3	Protein_coding	5'UTR	0.011047	0.026586	31	58	NA	NA
SRR4045276	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.007179	None	85	112	13	114.034580
SRR4045276_alt	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.007179	None	85	112	13	114.034580
GSE45833_4	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.00751	None	85	112	58	464.128385
GSE45833_4_alt	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.00751	None	85	112	58	464.128385
GSE103308	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.021221	None	85	112	123	405.222647
GSE103308_alt	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.021221	None	85	112	123	405.222647
GSE58207_alt	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.012701	0.044016	85	112	105	400.503118
SRR618770,618771,618772,618773_alt	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.036684	9.522E-17	85	112	49	306.372319
SRR964946_alt	ENSG00000164305.19	ENST00000523916.5	CASP3	Protein_coding	5'UTR	0.011047	0.012865	85	112	NA	NA

Min Ribo P value	0.007179
Min TIS P value	9.522E-17

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE103308	RD-muscle	WT	GSM2760247	29696588;
GSE103308_alt	RD-muscle	WT	GSM2760247	29696588;
GSE45833_4	BJ cells	Proliferation	GSM1047589	23594524;
GSE45833_4_alt	BJ cells	Proliferation	GSM1047589	23594524;
GSE58207_alt	HCT116	Colorectal carcinoma	GSM1403307; GSM1403308	25510491;
SRR4045276	Meg01 cells	WT	GSM2285909	27681415;
SRR4045276_alt	Meg01 cells	WT	GSM2285909	27681415;
SRR618770,618771,618772,618773_alt	HEK293	WT	SRR618770; SRR618771; SRR618772; SRR618773	NA;
SRR964946_alt	HEK293	WT	SRR964946	22927429;

Database information

No results

Literature information

PMID	26687005;
Cell lines Or Tissues	BJ
Phenotype	NULL
Gene ID	ENSG00000164305
Transcript ID	ENST00000523916
Symbol	CASP3
ORF Type	sORF
Gene Type	protein_coding
Throughput	High-throughput Literature Mining
Interaction	NA
Function Description	NA

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
4-184649399-T-C	Stop Loss p.*9W	rs113420705	SRR3208885; SRR3208921; SRR5227294; SRR6181541; SRR627625; SRR810100

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results

a reliable repository with comprehensive annotation of small proteins derived from ribosome profiling