Specific Information of Small Protein : SPROHSA206636
General Information
Small Protein ID | SPROHSA206636 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MGAIVRRL* |
RNA Sequence | ATGGGTGCTATTGTGAGGCGGTTGTAG |
Protein Length | 8 |
Start Codon | ATG |
Location | chr4:184649397-184649424:- |
Blocks | 184649397-184649424 |
Mean PhyloCSF | -8.11011120125 |
Data Source | Ribosome profiling; Literature; |
Related Genes | ENSG00000164305; CASP3; |
Mass (Da) | mono. 914.5; avg. 915.2 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR4045276 | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 23 | 50 | 13 | 114.034580 |
SRR4045276_alt | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 23 | 50 | 13 | 114.034580 |
GSE45833_4 | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 23 | 50 | 58 | 464.128385 |
GSE45833_4_alt | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 23 | 50 | 58 | 464.128385 |
SRR4045276 | ENSG00000164305.19 | ENST00000447121.2 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 23 | 50 | 13 | 114.034580 |
SRR4045276_alt | ENSG00000164305.19 | ENST00000447121.2 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 23 | 50 | 13 | 114.034580 |
GSE45833_4 | ENSG00000164305.19 | ENST00000447121.2 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 23 | 50 | 58 | 464.128385 |
GSE45833_4_alt | ENSG00000164305.19 | ENST00000447121.2 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 23 | 50 | 58 | 464.128385 |
SRR4045276 | ENSG00000164305.19 | ENST00000517513.5 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 23 | 50 | 13 | 114.034580 |
SRR4045276_alt | ENSG00000164305.19 | ENST00000517513.5 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 23 | 50 | 13 | 114.034580 |
GSE45833_4 | ENSG00000164305.19 | ENST00000517513.5 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 23 | 50 | 58 | 464.128385 |
GSE45833_4_alt | ENSG00000164305.19 | ENST00000517513.5 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 23 | 50 | 58 | 464.128385 |
GSE103308 | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 23 | 50 | 123 | 405.222647 |
GSE103308 | ENSG00000164305.19 | ENST00000447121.2 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 23 | 50 | 123 | 405.222647 |
GSE103308 | ENSG00000164305.19 | ENST00000517513.5 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 23 | 50 | 123 | 405.222647 |
GSE103308_alt | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 23 | 50 | 123 | 405.222647 |
GSE103308_alt | ENSG00000164305.19 | ENST00000447121.2 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 23 | 50 | 123 | 405.222647 |
GSE103308_alt | ENSG00000164305.19 | ENST00000517513.5 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 23 | 50 | 123 | 405.222647 |
GSE58207_alt | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.009683 | 0.044016 | 23 | 50 | 106 | 404.317434 |
SRR618770,618771,618772,618773_alt | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.014355 | 9.522E-17 | 23 | 50 | 50 | 312.624815 |
SRR618770,618771,618772,618773_alt | ENSG00000164305.19 | ENST00000447121.2 | CASP3 | Protein_coding | 5'UTR | 0.014355 | 2.776E-09 | 23 | 50 | 50 | 312.624815 |
SRR618770,618771,618772,618773_alt | ENSG00000164305.19 | ENST00000517513.5 | CASP3 | Protein_coding | 5'UTR | 0.014355 | 2.776E-09 | 23 | 50 | 50 | 312.624815 |
SRR964946_alt | ENSG00000164305.19 | ENST00000308394.9 | CASP3 | Protein_coding | 5'UTR | 0.011047 | 0.012865 | 23 | 50 | NA | NA |
SRR964946_alt | ENSG00000164305.19 | ENST00000447121.2 | CASP3 | Protein_coding | 5'UTR | 0.011047 | 0.046275 | 23 | 50 | NA | NA |
SRR964946_alt | ENSG00000164305.19 | ENST00000517513.5 | CASP3 | Protein_coding | 5'UTR | 0.011047 | 0.026586 | 23 | 50 | NA | NA |
SRR4045276 | ENSG00000164305.19 | ENST00000393588.8 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 31 | 58 | 13 | 114.034580 |
SRR4045276_alt | ENSG00000164305.19 | ENST00000393588.8 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 31 | 58 | 13 | 114.034580 |
GSE45833_4 | ENSG00000164305.19 | ENST00000393588.8 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 31 | 58 | 58 | 464.128385 |
GSE45833_4_alt | ENSG00000164305.19 | ENST00000393588.8 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 31 | 58 | 58 | 464.128385 |
GSE103308 | ENSG00000164305.19 | ENST00000393588.8 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 31 | 58 | 123 | 405.222647 |
GSE103308_alt | ENSG00000164305.19 | ENST00000393588.8 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 31 | 58 | 123 | 405.222647 |
SRR618770,618771,618772,618773_alt | ENSG00000164305.19 | ENST00000393588.8 | CASP3 | Protein_coding | 5'UTR | 0.036684 | 2.776E-09 | 31 | 58 | 49 | 306.372319 |
SRR964946_alt | ENSG00000164305.19 | ENST00000393588.8 | CASP3 | Protein_coding | 5'UTR | 0.011047 | 0.026586 | 31 | 58 | NA | NA |
SRR4045276 | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 85 | 112 | 13 | 114.034580 |
SRR4045276_alt | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.007179 | None | 85 | 112 | 13 | 114.034580 |
GSE45833_4 | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 85 | 112 | 58 | 464.128385 |
GSE45833_4_alt | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.00751 | None | 85 | 112 | 58 | 464.128385 |
GSE103308 | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 85 | 112 | 123 | 405.222647 |
GSE103308_alt | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.021221 | None | 85 | 112 | 123 | 405.222647 |
GSE58207_alt | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.012701 | 0.044016 | 85 | 112 | 105 | 400.503118 |
SRR618770,618771,618772,618773_alt | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.036684 | 9.522E-17 | 85 | 112 | 49 | 306.372319 |
SRR964946_alt | ENSG00000164305.19 | ENST00000523916.5 | CASP3 | Protein_coding | 5'UTR | 0.011047 | 0.012865 | 85 | 112 | NA | NA |
Min Ribo P value | 0.007179 |
Min TIS P value | 9.522E-17 |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE103308 | RD-muscle | WT | GSM2760247 | 29696588; |
GSE103308_alt | RD-muscle | WT | GSM2760247 | 29696588; |
GSE45833_4 | BJ cells | Proliferation | GSM1047589 | 23594524; |
GSE45833_4_alt | BJ cells | Proliferation | GSM1047589 | 23594524; |
GSE58207_alt | HCT116 | Colorectal carcinoma | GSM1403307; GSM1403308 | 25510491; |
SRR4045276 | Meg01 cells | WT | GSM2285909 | 27681415; |
SRR4045276_alt | Meg01 cells | WT | GSM2285909 | 27681415; |
SRR618770,618771,618772,618773_alt | HEK293 | WT | SRR618770; SRR618771; SRR618772; SRR618773 | NA; |
SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Literature information
PMID | 26687005; |
Cell lines Or Tissues | BJ |
Phenotype | NULL |
Gene ID | ENSG00000164305 |
Transcript ID | ENST00000523916 |
Symbol | CASP3 |
ORF Type | sORF |
Gene Type | protein_coding |
Throughput | High-throughput Literature Mining |
Interaction | NA |
Function Description | NA |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
4-184649399-T-C | Stop Loss p.*9W | rs113420705 | SRR3208885; SRR3208921; SRR5227294; SRR6181541; SRR627625; SRR810100 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |