Specific Information of Small Protein : SPROHSA204985
General Information
Small Protein ID | SPROHSA204985 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MGQPGPSAV* |
RNA Sequence | ATGGGGCAGCCTGGGCCTTCTGCAGTGTGA |
Protein Length | 9 |
Start Codon | ATG |
Location | chr8:123768564-123768594:+ |
Blocks | 123768564-123768594 |
Mean PhyloCSF | -0.833699995279 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000176853; FAM91A1; |
Mass (Da) | mono. 842.4; avg. 843 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45785_5 | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.007633 | None | 109 | 139 | 16 | 552.508127 |
GSE45785_5_alt | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.007633 | None | 109 | 139 | 16 | 552.508127 |
GSE45833_5 | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.018921 | None | 109 | 139 | 9 | 115.629349 |
GSE45833_5_alt | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.018921 | None | 109 | 139 | 9 | 115.629349 |
SRR3208921 | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.041966 | None | 109 | 139 | 28 | 207.465313 |
SRR3208921_alt | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.041966 | None | 109 | 139 | 28 | 207.465313 |
GSE83493 | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.010575 | None | 109 | 139 | 32 | 127.830149 |
GSE83493_alt | ENSG00000176853.16 | ENST00000521166.5 | FAM91A1 | Protein_coding | 5'UTR | 0.010575 | None | 109 | 139 | 32 | 127.830149 |
GSE45785_5 | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.007633 | None | 126 | 156 | 16 | 552.508127 |
GSE45785_5_alt | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.007633 | None | 126 | 156 | 16 | 552.508127 |
GSE45833_5 | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.018921 | None | 126 | 156 | 9 | 115.629349 |
GSE45833_5_alt | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.018921 | None | 126 | 156 | 9 | 115.629349 |
SRR3208921 | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.041966 | None | 126 | 156 | 28 | 207.465313 |
SRR3208921_alt | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.041966 | None | 126 | 156 | 28 | 207.465313 |
GSE83493 | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.010575 | None | 126 | 156 | 32 | 127.830149 |
GSE83493_alt | ENSG00000176853.16 | ENST00000334705.12 | FAM91A1 | Protein_coding | 5'UTR | 0.010575 | None | 126 | 156 | 32 | 127.830149 |
Min Ribo P value | 0.007633 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45785_5 | BJ cells | Immortalized | GSM1115216 | 23594524; |
GSE45785_5_alt | BJ cells | Immortalized | GSM1115216 | 23594524; |
GSE45833_5 | BJ cells | Senescence | GSM1047590 | 23594524; |
GSE45833_5_alt | BJ cells | Senescence | GSM1047590 | 23594524; |
GSE83493 | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
GSE83493_alt | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
SRR3208921 | ES cell-derived neurons TSC2-/- | Tuberous sclerosis complex | GSM2082573 | 27655340; |
SRR3208921_alt | ES cell-derived neurons TSC2-/- | Tuberous sclerosis complex | GSM2082573 | 27655340; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Skin cancer | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
8-123768581-C-T | Non-Synonymous p.P6L | rs142309473 | SRR5350740 |
8-123768584-C-A | Non-Synonymous p.S7Y | rs12334564 | SRR2818787; SRR2818791; SRR3208885; SRR3208921; SRR3317843; SRR3575897; SRR3575898; SRR4450331; SRR4450332; SRR5047770; SRR5047771; SRR5047772; SRR5227295; SRR5227296; SRR5239050; SRR5239051; SRR5239052; SRR5239056; SRR5239057; SRR5239058; SRR5350740; SRR5350744; SRR5350745; SRR5382423; SRR5382424; SRR6053333; SRR6053334; SRR6838651; SRR7207252; SRR8907185; SRR8310196; SRR8310197; SRR8310198; SRR8310199; SRR8310200; SRR1333393; SRR1333394; SRR627622; SRR627623; SRR627624; SRR627625; SRR627626; SRR627627; SRR810100; SRR810101; SRR810102; SRR810103; SRR810104; SRR1795425; SRR1795427; SRR1795428; SRR964946; SRR618770 |
8-123768587-C-T | Non-Synonymous p.A8V | . | SRR8310198 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |