SmProt

Specific Information of Small Protein : SPROHSA202216

General Information

Small Protein ID	SPROHSA202216
Organism	Human (Homo sapiens)
Small Protein Sequence	MGSATCFCLNHGPII*
RNA Sequence	ATGGGATCAGCTACCTGTTTCTGCCTCAACCACGGACCAATAATATGA
Protein Length	15
Start Codon	ATG
Location	chr9:34336235-34336283:+
Blocks	34336235-34336283
Mean PhyloCSF	-8.76887509227
Data Source	Ribosome profiling;
Related Genes	ENSG00000164978; NUDT2;
Mass (Da)	mono. 1562.7; avg. 1563.9

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE83493	ENSG00000164978.18	ENST00000379158.7	NUDT2	Protein_coding	5'UTR	0.009353	None	38	86	5	12.4834130
GSE83493_alt	ENSG00000164978.18	ENST00000379158.7	NUDT2	Protein_coding	5'UTR	0.009353	None	38	86	5	12.4834130

Min Ribo P value	0.009353
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE83493	HeLa S3	Cervical cancer	GSM2204389; GSM2204390; GSM2204391; GSM2204392	28460002;
GSE83493_alt	HeLa S3	Cervical cancer	GSM2204389; GSM2204390; GSM2204391; GSM2204392	28460002;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
Cervical cancer	Predicted by Ribo-seq

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
9-34336268-C-T	Synonymous p.H11H	rs7025269	SRR3575898; SRR4045276; SRR5047771; SRR5047772; SRR5227294; SRR5239056; SRR5239057; SRR618771; SRR618773

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results