Specific Information of Small Protein : SPROHSA191030
General Information
Small Protein ID | SPROHSA191030 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MATTESHATQ* |
RNA Sequence | ATGGCAACTACAGAATCACATGCCACACAGTGA |
Protein Length | 10 |
Start Codon | ATG |
Location | chr1:11114407-11114440:- |
Blocks | 11114407-11114440 |
Mean PhyloCSF | 7.2427575805 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000198793; MTOR; |
Mass (Da) | mono. 1075.5; avg. 1076.1 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR5350744 | ENSG00000198793.12 | ENST00000473471.5 | MTOR | Protein_coding | Novel | 0.032536 | None | 189 | 222 | 4 | 47.1687277 |
SRR5350744_alt | ENSG00000198793.12 | ENST00000473471.5 | MTOR | Protein_coding | Novel | 0.032536 | None | 189 | 222 | 4 | 47.1687277 |
SRR5350744 | ENSG00000198793.12 | ENST00000490931.1 | MTOR | Protein_coding | Novel | 0.032536 | None | 220 | 253 | 4 | 47.1687277 |
SRR5350744_alt | ENSG00000198793.12 | ENST00000490931.1 | MTOR | Protein_coding | Novel | 0.032536 | None | 220 | 253 | 4 | 47.1687277 |
SRR5350744 | ENSG00000198793.12 | ENST00000376838.5 | MTOR | Protein_coding | Internal | 0.032536 | None | 2594 | 2627 | 4 | 47.1687277 |
SRR5350744_alt | ENSG00000198793.12 | ENST00000376838.5 | MTOR | Protein_coding | Internal | 0.032536 | None | 2594 | 2627 | 4 | 47.1687277 |
SRR5350744 | ENSG00000198793.12 | ENST00000455339.1 | MTOR | Protein_coding | Internal | 0.032536 | None | 356 | 389 | 4 | 47.1687277 |
SRR5350744_alt | ENSG00000198793.12 | ENST00000455339.1 | MTOR | Protein_coding | Internal | 0.032536 | None | 356 | 389 | 4 | 47.1687277 |
SRR5350744 | ENSG00000198793.12 | ENST00000361445.8 | MTOR | Protein_coding | Internal | 0.032536 | None | 7254 | 7287 | 4 | 47.1687277 |
SRR5350744_alt | ENSG00000198793.12 | ENST00000361445.8 | MTOR | Protein_coding | Internal | 0.032536 | None | 7254 | 7287 | 4 | 47.1687277 |
Min Ribo P value | 0.032536 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
SRR5350744 | PC9 | NSCLC | GSM2538903 | 28388414; |
SRR5350744_alt | PC9 | NSCLC | GSM2538903 | 28388414; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |