Specific Information of Small Protein : SPROHSA172471
General Information
Small Protein ID | SPROHSA172471 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MRMDCGRQRLP* |
RNA Sequence | ATGCGGATGGATTGTGGTCGTCAGAGGCTCCCGTAG |
Protein Length | 11 |
Start Codon | ATG |
Location | chr17:6640914-6640950:+ |
Blocks | 6640914-6640950 |
Mean PhyloCSF | -8.36924990018 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000129235; TXNDC17; |
Mass (Da) | mono. 1361.6; avg. 1362.6 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE83493 | ENSG00000129235.10 | ENST00000250101.9 | TXNDC17 | Protein_coding | 5'UTR | 0.005814 | None | 157 | 193 | 11 | 36.6180115 |
GSE83493_alt | ENSG00000129235.10 | ENST00000250101.9 | TXNDC17 | Protein_coding | 5'UTR | 0.005814 | None | 157 | 193 | 11 | 36.6180115 |
Min Ribo P value | 0.005814 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE83493 | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
GSE83493_alt | HeLa S3 | Cervical cancer | GSM2204389; GSM2204390; GSM2204391; GSM2204392 | 28460002; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Cervical cancer | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
17-6640928-G-A | Non-Synonymous p.C5Y | rs1157900 | SRR3208885; SRR6181538; SRR3680966; SRR3680967; SRR3680968; SRR3680969; SRR618771; SRR618773 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |