SmProt

Specific Information of Small Protein : SPROHSA172471

General Information

Small Protein ID	SPROHSA172471
Organism	Human (Homo sapiens)
Small Protein Sequence	MRMDCGRQRLP*
RNA Sequence	ATGCGGATGGATTGTGGTCGTCAGAGGCTCCCGTAG
Protein Length	11
Start Codon	ATG
Location	chr17:6640914-6640950:+
Blocks	6640914-6640950
Mean PhyloCSF	-8.36924990018
Data Source	Ribosome profiling;
Related Genes	ENSG00000129235; TXNDC17;
Mass (Da)	mono. 1361.6; avg. 1362.6

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE83493	ENSG00000129235.10	ENST00000250101.9	TXNDC17	Protein_coding	5'UTR	0.005814	None	157	193	11	36.6180115
GSE83493_alt	ENSG00000129235.10	ENST00000250101.9	TXNDC17	Protein_coding	5'UTR	0.005814	None	157	193	11	36.6180115

Min Ribo P value	0.005814
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE83493	HeLa S3	Cervical cancer	GSM2204389; GSM2204390; GSM2204391; GSM2204392	28460002;
GSE83493_alt	HeLa S3	Cervical cancer	GSM2204389; GSM2204390; GSM2204391; GSM2204392	28460002;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
Cervical cancer	Predicted by Ribo-seq

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
17-6640928-G-A	Non-Synonymous p.C5Y	rs1157900	SRR3208885; SRR6181538; SRR3680966; SRR3680967; SRR3680968; SRR3680969; SRR618771; SRR618773

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results