Specific Information of Small Protein : SPROHSA152846
General Information
| Small Protein ID | SPROHSA152846 | ||
| Organism | human (Homo sapiens) | ||
| Small Protein Sequence | MSDTHKHRTTQPVPGAQ* | ||
| RNA Sequence | ATGAGCGACACACACAAACACAGAACCACACAGCCAGTCCCAGGAGCCCAGTAA | ||
| Protein Length | 17 | ||
| Start Codon | ATG | ||
| Location | chrX:52515526-52516666:- | ||
| Blocks | 52515526-52515573,52516659-52516666 | ||
| Mean PhyloCSF | -3.57625925099 | ||
| Data Source | Ribosome profiling; | ||
| Related Genes | ENSG00000204382; XAGE1B; | ||
Ribosome profiling
| RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
|---|---|---|---|---|---|---|---|---|---|
| SRR4045276 | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | protein_coding | Novel | 0.035937 | None | 346 | 400 |
| SRR4045276_alt | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | protein_coding | Novel | 0.035937 | None | 346 | 400 |
| GSE94613_2 | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | protein_coding | Novel | 0.002908 | None | 346 | 400 |
| GSE94613_2_alt | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | protein_coding | Novel | 0.002908 | None | 346 | 400 |
| GSE94613_1 | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | protein_coding | Novel | 0.031394 | None | 346 | 400 |
| GSE94613_1_alt | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | protein_coding | Novel | 0.031394 | None | 346 | 400 |
| Min Ribo Pvalue | 0.002908 |
| Min TIS Pvalue | None |
| RiboID | CellORTissue | Phenotype | RiboSource | PMID |
|---|---|---|---|---|
| GSE94613_1 | MOLM13 | acute myeloid leukemia | GSM2481052 | 29186125; |
| GSE94613_1_alt | MOLM13 | acute myeloid leukemia | GSM2481052 | 29186125; |
| GSE94613_2 | MOLM13 | acute myeloid leukemia | GSM2481053 | 29186125; |
| GSE94613_2_alt | MOLM13 | acute myeloid leukemia | GSM2481053 | 29186125; |
| SRR4045276 | Meg01 cells | WT | GSM2285909 | 27681415; |
| SRR4045276_alt | Meg01 cells | WT | GSM2285909 | 27681415; |
Database information
| No results |
Literature information
| No results |
Mass Spectrometry Information
| No results |
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|---|---|---|---|---|---|---|---|---|---|
| No results | ||||||||||
| Disease | Detected |
|---|---|
| acute myeloid leukemia | PredictedByRibo |
Related Variants
| VarID | Consequence To sORF | rsID | RiboID |
|---|---|---|---|
| No results | |||
Related Small Proteins with Different TISs
| ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|---|---|---|---|
| No results | ||||
References
| PMID | 27681415 |
| Title | Dynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets |
| Journal | Cell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088. |
| Authors | Eric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia |
| PMID | 29186125 |
| Title | Promoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control |
| Journal | Nature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27. |
| Authors | Isaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides |