Specific Information of Small Protein : SPROHSA152846
General Information
Small Protein IDSPROHSA152846
Organismhuman (Homo sapiens)
Small Protein SequenceMSDTHKHRTTQPVPGAQ*
RNA SequenceATGAGCGACACACACAAACACAGAACCACACAGCCAGTCCCAGGAGCCCAGTAA
Protein Length17
Start CodonATG
LocationchrX:52515526-52516666:-
Blocks52515526-52515573,52516659-52516666
Mean PhyloCSF-3.57625925099
Data SourceRibosome profiling;
Related GenesENSG00000204382; XAGE1B;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR4045276ENSG00000204382.11ENST00000375612.8XAGE1Bprotein_codingNovel0.035937None346400
SRR4045276_altENSG00000204382.11ENST00000375612.8XAGE1Bprotein_codingNovel0.035937None346400
GSE94613_2ENSG00000204382.11ENST00000375612.8XAGE1Bprotein_codingNovel0.002908None346400
GSE94613_2_altENSG00000204382.11ENST00000375612.8XAGE1Bprotein_codingNovel0.002908None346400
GSE94613_1ENSG00000204382.11ENST00000375612.8XAGE1Bprotein_codingNovel0.031394None346400
GSE94613_1_altENSG00000204382.11ENST00000375612.8XAGE1Bprotein_codingNovel0.031394None346400
Min Ribo Pvalue0.002908
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_1MOLM13acute myeloid leukemiaGSM248105229186125;
GSE94613_1_altMOLM13acute myeloid leukemiaGSM248105229186125;
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
GSE94613_2_altMOLM13acute myeloid leukemiaGSM248105329186125;
SRR4045276Meg01 cellsWTGSM228590927681415;
SRR4045276_altMeg01 cellsWTGSM228590927681415;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID27681415
TitleDynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets
JournalCell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088.
AuthorsEric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides