Specific Information of Small Protein : SPROHSA152846
General Information
| Small Protein ID | SPROHSA152846 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MSDTHKHRTTQPVPGAQ* |
| RNA Sequence | ATGAGCGACACACACAAACACAGAACCACACAGCCAGTCCCAGGAGCCCAGTAA |
| Protein Length | 17 |
| Start Codon | ATG |
| Location | chrX:52515526-52516666:- |
| Blocks | 52515526-52515573,52516659-52516666 |
| Mean PhyloCSF | -3.57625925099 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000204382; XAGE1B; |
| Mass (Da) | mono. 1889.9; avg. 1891.1 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| SRR4045276 | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | Protein_coding | Novel | 0.035937 | None | 346 | 400 | 33 | 144.736198 |
| SRR4045276_alt | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | Protein_coding | Novel | 0.035937 | None | 346 | 400 | 33 | 144.736198 |
| GSE94613_2 | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | Protein_coding | Novel | 0.002908 | None | 346 | 400 | 32 | 123.309024 |
| GSE94613_2_alt | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | Protein_coding | Novel | 0.002908 | None | 346 | 400 | 32 | 123.309024 |
| GSE94613_1 | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | Protein_coding | Novel | 0.031394 | None | 346 | 400 | 13 | 139.062529 |
| GSE94613_1_alt | ENSG00000204382.11 | ENST00000375612.8 | XAGE1B | Protein_coding | Novel | 0.031394 | None | 346 | 400 | 13 | 139.062529 |
| Min Ribo P value | 0.002908 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE94613_1 | MOLM13 | Acute myeloid leukemia | GSM2481052 | 29186125; |
| GSE94613_1_alt | MOLM13 | Acute myeloid leukemia | GSM2481052 | 29186125; |
| GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
| GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
| SRR4045276 | Meg01 cells | WT | GSM2285909 | 27681415; |
| SRR4045276_alt | Meg01 cells | WT | GSM2285909 | 27681415; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| No results |
SmProt