Specific Information of Small Protein : SPROHSA151603
General Information
| Small Protein ID | SPROHSA151603 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MRGDREKRPLVSVRMPCFLHLCFRRPRG* |
| RNA Sequence | ATGAGAGGTGACAGAGAGAAGAGGCCATTGGTCTCAGTAAGAATGCCCTGCTTTCTGCATCTCTGTTTCAGAAGACCAAGAGGGTGA |
| Protein Length | 28 |
| Start Codon | ATG |
| Location | chr18:2802548-2802635:+ |
| Blocks | 2802548-2802635 |
| Mean PhyloCSF | -7.28203442179 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000101596; SMCHD1; ENSG00000266049; AP001011.1; NONHSAG023207; |
| Mass (Da) | mono. 3411.8; avg. 3414.1 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE94613_2 | ENSG00000101596.15 | ENST00000642953.1 | SMCHD1 | Protein_coding | 3'UTR | 0.003214 | None | 1009 | 1096 | 6 | 14.3506192 |
| GSE94613_2_alt | ENSG00000101596.15 | ENST00000642953.1 | SMCHD1 | Protein_coding | 3'UTR | 0.003214 | None | 1009 | 1096 | 6 | 14.3506192 |
| GSE94613_2 | ENSG00000101596.15 | ENST00000645355.1 | SMCHD1 | Protein_coding | 3'UTR | 0.003214 | None | 2059 | 2146 | 6 | 14.3506192 |
| GSE94613_2_alt | ENSG00000101596.15 | ENST00000645355.1 | SMCHD1 | Protein_coding | 3'UTR | 0.003214 | None | 2059 | 2146 | 6 | 14.3506192 |
| GSE94613_2 | ENSG00000101596.15 | ENST00000584897.5 | SMCHD1 | Protein_coding | 3'UTR | 0.003214 | None | 3763 | 3850 | 6 | 14.3506192 |
| GSE94613_2_alt | ENSG00000101596.15 | ENST00000584897.5 | SMCHD1 | Protein_coding | 3'UTR | 0.003214 | None | 3763 | 3850 | 6 | 14.3506192 |
| GSE94613_2 | ENSG00000101596.15 | ENST00000577880.5 | SMCHD1 | Protein_coding | 3'UTR | 0.003214 | None | 4570 | 4657 | 6 | 14.3506192 |
| GSE94613_2_alt | ENSG00000101596.15 | ENST00000577880.5 | SMCHD1 | Protein_coding | 3'UTR | 0.003214 | None | 4570 | 4657 | 6 | 14.3506192 |
| GSE94613_2 | ENSG00000101596.15 | ENST00000320876.10 | SMCHD1 | Protein_coding | Internal | 0.003214 | None | 6352 | 6439 | 6 | 14.3506192 |
| GSE94613_2_alt | ENSG00000101596.15 | ENST00000320876.10 | SMCHD1 | Protein_coding | Internal | 0.003214 | None | 6352 | 6439 | 6 | 14.3506192 |
| Min Ribo P value | 0.003214 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
| GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| No results |
SmProt