Specific Information of Small Protein : SPROHSA151603
General Information
Small Protein IDSPROHSA151603
Organismhuman (Homo sapiens)
Small Protein SequenceMRGDREKRPLVSVRMPCFLHLCFRRPRG*
RNA SequenceATGAGAGGTGACAGAGAGAAGAGGCCATTGGTCTCAGTAAGAATGCCCTGCTTTCTGCATCTCTGTTTCAGAAGACCAAGAGGGTGA
Protein Length28
Start CodonATG
Locationchr18:2802548-2802635:+
Blocks2802548-2802635
Mean PhyloCSF-7.28203442179
Data SourceRibosome profiling;
Related GenesENSG00000101596; SMCHD1; ENSG00000266049; AP001011.1; NONHSAG023207;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94613_2ENSG00000101596.15ENST00000642953.1SMCHD1protein_coding3'UTR0.003214None10091096
GSE94613_2_altENSG00000101596.15ENST00000642953.1SMCHD1protein_coding3'UTR0.003214None10091096
GSE94613_2ENSG00000101596.15ENST00000645355.1SMCHD1protein_coding3'UTR0.003214None20592146
GSE94613_2_altENSG00000101596.15ENST00000645355.1SMCHD1protein_coding3'UTR0.003214None20592146
GSE94613_2ENSG00000101596.15ENST00000584897.5SMCHD1protein_coding3'UTR0.003214None37633850
GSE94613_2_altENSG00000101596.15ENST00000584897.5SMCHD1protein_coding3'UTR0.003214None37633850
GSE94613_2ENSG00000101596.15ENST00000577880.5SMCHD1protein_coding3'UTR0.003214None45704657
GSE94613_2_altENSG00000101596.15ENST00000577880.5SMCHD1protein_coding3'UTR0.003214None45704657
GSE94613_2ENSG00000101596.15ENST00000320876.10SMCHD1protein_codingInternal0.003214None63526439
GSE94613_2_altENSG00000101596.15ENST00000320876.10SMCHD1protein_codingInternal0.003214None63526439
Min Ribo Pvalue0.003214
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
GSE94613_2_altMOLM13acute myeloid leukemiaGSM248105329186125;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides