Specific Information of Small Protein : SPROHSA150998
General Information
Small Protein ID | SPROHSA150998 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MRPNFCDAYELGLDS* |
RNA Sequence | ATGAGACCAAACTTTTGCGACGCGTACGAGCTGGGACTCGACTCCTGA |
Protein Length | 15 |
Start Codon | ATG |
Location | chr2:231464015-231464063:- |
Blocks | 231464015-231464063 |
Mean PhyloCSF | -6.99456253648 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000115053; NCL; NONHSAG079454; |
Mass (Da) | mono. 1729.7; avg. 1730.9 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR4045276 | ENSG00000115053.16 | ENST00000453992.5 | NCL | Protein_coding | 5'UTR | 0.032377 | None | 117 | 165 | 3 | 14.8025657 |
SRR4045276_alt | ENSG00000115053.16 | ENST00000453992.5 | NCL | Protein_coding | 5'UTR | 0.032377 | None | 117 | 165 | 3 | 14.8025657 |
GSE94613_2 | ENSG00000115053.16 | ENST00000453992.5 | NCL | Protein_coding | 5'UTR | 0.009353 | None | 117 | 165 | 4 | 17.3403316 |
GSE94613_2_alt | ENSG00000115053.16 | ENST00000453992.5 | NCL | Protein_coding | 5'UTR | 0.009353 | None | 117 | 165 | 4 | 17.3403316 |
Min Ribo P value | 0.009353 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
SRR4045276 | Meg01 cells | WT | GSM2285909 | 27681415; |
SRR4045276_alt | Meg01 cells | WT | GSM2285909 | 27681415; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |