SmProt

Specific Information of Small Protein : SPROHSA150998

General Information

Small Protein ID	SPROHSA150998
Organism	Human (Homo sapiens)
Small Protein Sequence	MRPNFCDAYELGLDS*
RNA Sequence	ATGAGACCAAACTTTTGCGACGCGTACGAGCTGGGACTCGACTCCTGA
Protein Length	15
Start Codon	ATG
Location	chr2:231464015-231464063:-
Blocks	231464015-231464063
Mean PhyloCSF	-6.99456253648
Data Source	Ribosome profiling;
Related Genes	ENSG00000115053; NCL; NONHSAG079454;
Mass (Da)	mono. 1729.7; avg. 1730.9

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
SRR4045276	ENSG00000115053.16	ENST00000453992.5	NCL	Protein_coding	5'UTR	0.032377	None	117	165	3	14.8025657
SRR4045276_alt	ENSG00000115053.16	ENST00000453992.5	NCL	Protein_coding	5'UTR	0.032377	None	117	165	3	14.8025657
GSE94613_2	ENSG00000115053.16	ENST00000453992.5	NCL	Protein_coding	5'UTR	0.009353	None	117	165	4	17.3403316
GSE94613_2_alt	ENSG00000115053.16	ENST00000453992.5	NCL	Protein_coding	5'UTR	0.009353	None	117	165	4	17.3403316

Min Ribo P value	0.009353
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE94613_2	MOLM13	Acute myeloid leukemia	GSM2481053	29186125;
GSE94613_2_alt	MOLM13	Acute myeloid leukemia	GSM2481053	29186125;
SRR4045276	Meg01 cells	WT	GSM2285909	27681415;
SRR4045276_alt	Meg01 cells	WT	GSM2285909	27681415;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
Acute myeloid leukemia	Predicted by Ribo-seq

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results