Specific Information of Small Protein : SPROHSA150998
General Information
Small Protein IDSPROHSA150998
Organismhuman (Homo sapiens)
Small Protein SequenceMRPNFCDAYELGLDS*
RNA SequenceATGAGACCAAACTTTTGCGACGCGTACGAGCTGGGACTCGACTCCTGA
Protein Length15
Start CodonATG
Locationchr2:231464015-231464063:-
Blocks231464015-231464063
Mean PhyloCSF-6.99456253648
Data SourceRibosome profiling;
Related GenesENSG00000115053; NCL; NONHSAG079454;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR4045276ENSG00000115053.16ENST00000453992.5NCLprotein_coding5'UTR0.032377None117165
SRR4045276_altENSG00000115053.16ENST00000453992.5NCLprotein_coding5'UTR0.032377None117165
GSE94613_2ENSG00000115053.16ENST00000453992.5NCLprotein_coding5'UTR0.009353None117165
GSE94613_2_altENSG00000115053.16ENST00000453992.5NCLprotein_coding5'UTR0.009353None117165
Min Ribo Pvalue0.009353
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
GSE94613_2_altMOLM13acute myeloid leukemiaGSM248105329186125;
SRR4045276Meg01 cellsWTGSM228590927681415;
SRR4045276_altMeg01 cellsWTGSM228590927681415;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID27681415
TitleDynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets
JournalCell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088.
AuthorsEric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides