Specific Information of Small Protein : SPROHSA148481
General Information
Small Protein IDSPROHSA148481
Organismhuman (Homo sapiens)
Small Protein SequenceMTHVRAKTWGRRRVVESGSIVGGERNIQDLKQLL*
RNA SequenceATGACGCACGTGCGCGCGAAGACGTGGGGACGCAGGCGGGTCGTAGAGAGCGGGTCCATTGTAGGGGGAGAAAGAAATATTCAGGATTTAAAGCAGCTGCTCTAA
Protein Length34
Start CodonATG
Locationchr2:226836036-226838126:+
Blocks226836036-226836087,226838072-226838126
Mean PhyloCSF-7.9186000824
Data SourceRibosome profiling;
Related GenesENSG00000144468; RHBDD1;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94613_2ENSG00000144468.17ENST00000437454.5RHBDD1protein_coding5'UTR0.004574None3108
Min Ribo Pvalue0.004574
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
CoilsCoil2034-T
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA4815733ACG+226836039-226836087,226838072-226838126
References
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides