Specific Information of Small Protein : SPROHSA143940
General Information
Small Protein ID | SPROHSA143940 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MNHDGPWEFPDN* |
RNA Sequence | ATGAATCATGACGGTCCCTGGGAATTTCCTGATAACTAA |
Protein Length | 12 |
Start Codon | ATG |
Location | chr10:73909240-73909279:+ |
Blocks | 73909240-73909279 |
Mean PhyloCSF | -7.16015382913 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000122861; PLAU; |
Mass (Da) | mono. 1457.6; avg. 1458.5 |
Ribosome profiling
Min Ribo P value | 0.00884 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
10-73909255-T-C | Synonymous p.G5G | rs2459449 | SRR5239052; SRR5239056; SRR5239057; SRR5239058; SRR3680966; SRR3680967 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |