Specific Information of Small Protein : SPROHSA143940
General Information
Small Protein IDSPROHSA143940
Organismhuman (Homo sapiens)
Small Protein SequenceMNHDGPWEFPDN*
RNA SequenceATGAATCATGACGGTCCCTGGGAATTTCCTGATAACTAA
Protein Length12
Start CodonATG
Locationchr10:73909240-73909279:+
Blocks73909240-73909279
Mean PhyloCSF-7.16015382913
Data SourceRibosome profiling;
Related GenesENSG00000122861; PLAU;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94613_2ENSG00000122861.16ENST00000481390.5PLAUprotein_coding5'UTR0.00884None64103
GSE94613_2_altENSG00000122861.16ENST00000481390.5PLAUprotein_coding5'UTR0.00884None64103
Min Ribo Pvalue0.00884
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
GSE94613_2_altMOLM13acute myeloid leukemiaGSM248105329186125;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
10-73909255-T-CSynonymous p.G5Grs2459449SRR5239052;SRR5239056;SRR5239057;SRR5239058;SRR3680966;SRR3680967
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides