Specific Information of Small Protein : SPROHSA143940
General Information
| Small Protein ID | SPROHSA143940 | ||
| Organism | human (Homo sapiens) | ||
| Small Protein Sequence | MNHDGPWEFPDN* | ||
| RNA Sequence | ATGAATCATGACGGTCCCTGGGAATTTCCTGATAACTAA | ||
| Protein Length | 12 | ||
| Start Codon | ATG | ||
| Location | chr10:73909240-73909279:+ | ||
| Blocks | 73909240-73909279 | ||
| Mean PhyloCSF | -7.16015382913 | ||
| Data Source | Ribosome profiling; | ||
| Related Genes | ENSG00000122861; PLAU; | ||
Ribosome profiling
| RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
|---|---|---|---|---|---|---|---|---|---|
| GSE94613_2 | ENSG00000122861.16 | ENST00000481390.5 | PLAU | protein_coding | 5'UTR | 0.00884 | None | 64 | 103 |
| GSE94613_2_alt | ENSG00000122861.16 | ENST00000481390.5 | PLAU | protein_coding | 5'UTR | 0.00884 | None | 64 | 103 |
| Min Ribo Pvalue | 0.00884 |
| Min TIS Pvalue | None |
Database information
| No results |
Literature information
| No results |
Mass Spectrometry Information
| No results |
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|---|---|---|---|---|---|---|---|---|---|
| No results | ||||||||||
| Disease | Detected |
|---|---|
| acute myeloid leukemia | PredictedByRibo |
Related Variants
| VarID | Consequence To sORF | rsID | RiboID |
|---|---|---|---|
| 10-73909255-T-C | Synonymous p.G5G | rs2459449 | SRR5239052;SRR5239056;SRR5239057;SRR5239058;SRR3680966;SRR3680967 |
Related Small Proteins with Different TISs
| ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|---|---|---|---|
| No results | ||||
References
| PMID | 29186125 |
| Title | Promoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control |
| Journal | Nature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27. |
| Authors | Isaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides |