Specific Information of Small Protein : SPROHSA143940
General Information
Small Protein IDSPROHSA143940
OrganismHuman (Homo sapiens)
Small Protein SequenceMNHDGPWEFPDN*
RNA SequenceATGAATCATGACGGTCCCTGGGAATTTCCTGATAACTAA
Protein Length12
Start CodonATG
Locationchr10:73909240-73909279:+
Blocks73909240-73909279
Mean PhyloCSF-7.16015382913
Data SourceRibosome profiling;
Related GenesENSG00000122861; PLAU;
Mass (Da)mono. 1457.6; avg. 1458.5
Ribosome profiling
Ribo-seq IDEnsembl Gene IDEnsembl Transcript IDSymbolGene TypeTIS TypeRibo P valueTIS P valueStart On TransStop On TransIn-frame CountRibo-seq RPKM
GSE94613_2ENSG00000122861.16ENST00000481390.5PLAUProtein_coding5'UTR0.00884None64103948.0193798
GSE94613_2_altENSG00000122861.16ENST00000481390.5PLAUProtein_coding5'UTR0.00884None64103948.0193798
Min Ribo P value0.00884
Min TIS P valueNone
Ribo-seq IDCell or TissuePhenotypeRibo-seq Source DetailsPMID
GSE94613_2MOLM13Acute myeloid leukemiaGSM248105329186125;
GSE94613_2_altMOLM13Acute myeloid leukemiaGSM248105329186125;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
Acute myeloid leukemiaPredicted by Ribo-seq
Related Variants
Variant IDConsequence to sORFrsIDRibo-seq ID
10-73909255-T-CSynonymous p.G5Grs2459449SRR5239052; SRR5239056; SRR5239057; SRR5239058; SRR3680966; SRR3680967
Related Small Proteins with Different TISs
SmProt IDSmall Protein LengthStart CodonStrandBlocks
No results