Specific Information of Small Protein : SPROHSA142601
General Information
Small Protein IDSPROHSA142601
Organismhuman (Homo sapiens)
Small Protein SequenceMKAVSGMKSDSSSFTTSSGALPALLPSIASSSVLPEF*
RNA SequenceATGAAGGCCGTTTCTGGAATGAAGTCTGACTCCTCCAGTTTCACCACCTCTTCCGGAGCTCTCCCCGCCTTGCTGCCTTCCATCGCTTCATCCTCGGTGCTTCCTGAGTTTTAA
Protein Length37
Start CodonATG
Locationchr8:11803331-11803445:+
Blocks11803331-11803445
Mean PhyloCSF-7.23371062153
Data SourceRibosome profiling;
Related GenesENSG00000079459; FDFT1;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE94613_2ENSG00000079459.13ENST00000525551.1FDFT1protein_codingNovel0.003419None158272
GSE94613_2ENSG00000079459.13ENST00000527045.1FDFT1protein_codingNovel0.003419None158272
GSE94613_2ENSG00000079459.13ENST00000525607.5FDFT1protein_codingInternal0.003419None201315
GSE94613_2ENSG00000079459.13ENST00000525571.1FDFT1protein_codingNovel0.003419None309423
GSE94613_2ENSG00000079459.13ENST00000528812.5FDFT1protein_coding5'UTR0.003419None320434
GSE94613_2ENSG00000079459.13ENST00000623368.3FDFT1protein_coding5'UTR0.003419None331445
Min Ribo Pvalue0.003419
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
8-11803407-C-TNon-Synonymous p.P26Srs2252567SRR5239051;SRR5239052
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
SPROHSA3232536AAG+11803334-11803445
References
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides