Specific Information of Small Protein : SPROHSA142326
General Information
| Small Protein ID | SPROHSA142326 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MKERGQG* |
| RNA Sequence | ATGAAGGAGAGGGGTCAGGGTTGA |
| Protein Length | 7 |
| Start Codon | ATG |
| Location | chrM:14270-14294:- |
| Blocks | 14270-14294 |
| Mean PhyloCSF | -12.9529583057 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000198695; MT-ND6; NONHSAG053892;NONHSAG103252; |
| Mass (Da) | mono. 804.4; avg. 804.9 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE94613_2 | ENSG00000198695.2 | ENST00000361681.2 | MT-ND6 | Protein_coding | Internal | 0.00779 | None | 379 | 403 | 10 | 86.7016580 |
| GSE94613_2_alt | ENSG00000198695.2 | ENST00000361681.2 | MT-ND6 | Protein_coding | Internal | 0.00779 | None | 379 | 403 | 10 | 86.7016580 |
| Min Ribo P value | 0.00779 |
| Min TIS P value | None |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
| GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| No results |
SmProt