Specific Information of Small Protein : SPROHSA142326
General Information
Small Protein ID | SPROHSA142326 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MKERGQG* |
RNA Sequence | ATGAAGGAGAGGGGTCAGGGTTGA |
Protein Length | 7 |
Start Codon | ATG |
Location | chrM:14270-14294:- |
Blocks | 14270-14294 |
Mean PhyloCSF | -12.9529583057 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000198695; MT-ND6; NONHSAG053892;NONHSAG103252; |
Mass (Da) | mono. 804.4; avg. 804.9 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE94613_2 | ENSG00000198695.2 | ENST00000361681.2 | MT-ND6 | Protein_coding | Internal | 0.00779 | None | 379 | 403 | 10 | 86.7016580 |
GSE94613_2_alt | ENSG00000198695.2 | ENST00000361681.2 | MT-ND6 | Protein_coding | Internal | 0.00779 | None | 379 | 403 | 10 | 86.7016580 |
Min Ribo P value | 0.00779 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |