Specific Information of Small Protein : SPROHSA139826
General Information
| Small Protein ID | SPROHSA139826 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MNCGVGC* |
| RNA Sequence | ATGAACTGTGGCGTGGGCTGCTAA |
| Protein Length | 7 |
| Start Codon | ATG |
| Location | chr5:131635061-131635085:- |
| Blocks | 131635061-131635085 |
| Mean PhyloCSF | -5.95112504562 |
| Data Source | Ribosome profiling; Literature; |
| Related Genes | ENSG00000158987; RAPGEF6; ENSG00000273217; AC008695.1; |
| Mass (Da) | mono. 682.2; avg. 682.8 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| GSE45833_6 | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 127 | 151 | 8 | 56.9576341 |
| GSE45833_6_alt | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 127 | 151 | 8 | 56.9576341 |
| GSE58207_alt | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 3.011E-23 | 127 | 151 | 48 | 205.973032 |
| GSE94613_2 | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 127 | 151 | 27 | 234.094476 |
| GSE94613_2_alt | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 127 | 151 | 27 | 234.094476 |
| SRR964946_alt | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 127 | 151 | NA | NA |
| GSE45833_6 | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 128 | 152 | 8 | 56.9576341 |
| GSE45833_6_alt | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 128 | 152 | 8 | 56.9576341 |
| GSE58207_alt | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 1.433E-13 | 128 | 152 | 48 | 205.973032 |
| GSE94613_2 | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 128 | 152 | 27 | 234.094476 |
| GSE94613_2_alt | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 128 | 152 | 27 | 234.094476 |
| SRR964946_alt | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 128 | 152 | NA | NA |
| GSE45833_6 | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 146 | 170 | 8 | 56.9576341 |
| GSE45833_6_alt | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 146 | 170 | 8 | 56.9576341 |
| GSE58207_alt | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 1.433E-13 | 146 | 170 | 48 | 205.973032 |
| GSE94613_2 | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 146 | 170 | 27 | 234.094476 |
| GSE94613_2_alt | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 146 | 170 | 27 | 234.094476 |
| SRR964946_alt | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.006517 | 146 | 170 | NA | NA |
| GSE45833_6 | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 151 | 175 | 8 | 56.9576341 |
| GSE45833_6_alt | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 151 | 175 | 8 | 56.9576341 |
| GSE58207_alt | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 3.011E-23 | 151 | 175 | 48 | 205.973032 |
| GSE94613_2 | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 151 | 175 | 27 | 234.094476 |
| GSE94613_2_alt | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 151 | 175 | 27 | 234.094476 |
| SRR964946_alt | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 151 | 175 | NA | NA |
| GSE45833_6 | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 26 | 50 | 8 | 56.9576341 |
| GSE45833_6_alt | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 26 | 50 | 8 | 56.9576341 |
| GSE58207_alt | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 3.011E-23 | 26 | 50 | 48 | 205.973032 |
| GSE94613_2 | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 26 | 50 | 27 | 234.094476 |
| GSE94613_2_alt | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 26 | 50 | 27 | 234.094476 |
| SRR964946_alt | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 26 | 50 | NA | NA |
| GSE45833_6 | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 74 | 98 | 8 | 56.9576341 |
| GSE45833_6_alt | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 74 | 98 | 8 | 56.9576341 |
| GSE58207_alt | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 3.011E-23 | 74 | 98 | 48 | 205.973032 |
| GSE94613_2 | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 74 | 98 | 27 | 234.094476 |
| GSE94613_2_alt | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 74 | 98 | 27 | 234.094476 |
| SRR964946_alt | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 74 | 98 | NA | NA |
| Min Ribo P value | 0.003038 |
| Min TIS P value | 3.011E-23 |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| GSE45833_6 | BJ cells | Transformed | GSM1047591 | 23594524; |
| GSE45833_6_alt | BJ cells | Transformed | GSM1047591 | 23594524; |
| GSE58207_alt | HCT116 | Colorectal carcinoma | GSM1403307; GSM1403308 | 25510491; |
| GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
| GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Literature information
| PMID | 26687005; |
| Cell lines Or Tissues | BJ |
| Phenotype | NULL |
| Gene ID | ENSG00000158987 |
| Transcript ID | ENST00000515170 |
| Symbol | NA |
| ORF Type | sORF |
| Gene Type | protein_coding |
| Throughput | High-throughput Literature Mining |
| Interaction | NA |
| Function Description | NA |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| No results |
SmProt