Specific Information of Small Protein : SPROHSA139826
General Information
Small Protein ID | SPROHSA139826 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MNCGVGC* |
RNA Sequence | ATGAACTGTGGCGTGGGCTGCTAA |
Protein Length | 7 |
Start Codon | ATG |
Location | chr5:131635061-131635085:- |
Blocks | 131635061-131635085 |
Mean PhyloCSF | -5.95112504562 |
Data Source | Ribosome profiling; Literature; |
Related Genes | ENSG00000158987; RAPGEF6; ENSG00000273217; AC008695.1; |
Mass (Da) | mono. 682.2; avg. 682.8 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE45833_6 | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 127 | 151 | 8 | 56.9576341 |
GSE45833_6_alt | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 127 | 151 | 8 | 56.9576341 |
GSE58207_alt | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 3.011E-23 | 127 | 151 | 48 | 205.973032 |
GSE94613_2 | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 127 | 151 | 27 | 234.094476 |
GSE94613_2_alt | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 127 | 151 | 27 | 234.094476 |
SRR964946_alt | ENSG00000158987.20 | ENST00000507093.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 127 | 151 | NA | NA |
GSE45833_6 | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 128 | 152 | 8 | 56.9576341 |
GSE45833_6_alt | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 128 | 152 | 8 | 56.9576341 |
GSE58207_alt | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 1.433E-13 | 128 | 152 | 48 | 205.973032 |
GSE94613_2 | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 128 | 152 | 27 | 234.094476 |
GSE94613_2_alt | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 128 | 152 | 27 | 234.094476 |
SRR964946_alt | ENSG00000158987.20 | ENST00000515170.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 128 | 152 | NA | NA |
GSE45833_6 | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 146 | 170 | 8 | 56.9576341 |
GSE45833_6_alt | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 146 | 170 | 8 | 56.9576341 |
GSE58207_alt | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 1.433E-13 | 146 | 170 | 48 | 205.973032 |
GSE94613_2 | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 146 | 170 | 27 | 234.094476 |
GSE94613_2_alt | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 146 | 170 | 27 | 234.094476 |
SRR964946_alt | ENSG00000158987.20 | ENST00000510071.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.006517 | 146 | 170 | NA | NA |
GSE45833_6 | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 151 | 175 | 8 | 56.9576341 |
GSE45833_6_alt | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 151 | 175 | 8 | 56.9576341 |
GSE58207_alt | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 3.011E-23 | 151 | 175 | 48 | 205.973032 |
GSE94613_2 | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 151 | 175 | 27 | 234.094476 |
GSE94613_2_alt | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 151 | 175 | 27 | 234.094476 |
SRR964946_alt | ENSG00000158987.20 | ENST00000509018.5 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 151 | 175 | NA | NA |
GSE45833_6 | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 26 | 50 | 8 | 56.9576341 |
GSE45833_6_alt | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 26 | 50 | 8 | 56.9576341 |
GSE58207_alt | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 3.011E-23 | 26 | 50 | 48 | 205.973032 |
GSE94613_2 | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 26 | 50 | 27 | 234.094476 |
GSE94613_2_alt | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 26 | 50 | 27 | 234.094476 |
SRR964946_alt | ENSG00000158987.20 | ENST00000296859.10 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 26 | 50 | NA | NA |
GSE45833_6 | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 74 | 98 | 8 | 56.9576341 |
GSE45833_6_alt | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.022398 | None | 74 | 98 | 8 | 56.9576341 |
GSE58207_alt | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.046747 | 3.011E-23 | 74 | 98 | 48 | 205.973032 |
GSE94613_2 | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 74 | 98 | 27 | 234.094476 |
GSE94613_2_alt | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.003038 | None | 74 | 98 | 27 | 234.094476 |
SRR964946_alt | ENSG00000158987.20 | ENST00000627212.2 | RAPGEF6 | Protein_coding | 5'UTR | 0.048748 | 0.000649 | 74 | 98 | NA | NA |
Min Ribo P value | 0.003038 |
Min TIS P value | 3.011E-23 |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE45833_6 | BJ cells | Transformed | GSM1047591 | 23594524; |
GSE45833_6_alt | BJ cells | Transformed | GSM1047591 | 23594524; |
GSE58207_alt | HCT116 | Colorectal carcinoma | GSM1403307; GSM1403308 | 25510491; |
GSE94613_2 | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
GSE94613_2_alt | MOLM13 | Acute myeloid leukemia | GSM2481053 | 29186125; |
SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Literature information
PMID | 26687005; |
Cell lines Or Tissues | BJ |
Phenotype | NULL |
Gene ID | ENSG00000158987 |
Transcript ID | ENST00000515170 |
Symbol | NA |
ORF Type | sORF |
Gene Type | protein_coding |
Throughput | High-throughput Literature Mining |
Interaction | NA |
Function Description | NA |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
Acute myeloid leukemia | Predicted by Ribo-seq |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |