Specific Information of Small Protein : SPROHSA139826
General Information
Small Protein IDSPROHSA139826
Organismhuman (Homo sapiens)
Small Protein SequenceMNCGVGC*
RNA SequenceATGAACTGTGGCGTGGGCTGCTAA
Protein Length7
Start CodonATG
Locationchr5:131635061-131635085:-
Blocks131635061-131635085
Mean PhyloCSF-5.95112504562
Data SourceRibosome profiling; Literature;
Related GenesENSG00000158987; RAPGEF6; ENSG00000273217; AC008695.1;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE45833_6ENSG00000158987.20ENST00000507093.5RAPGEF6protein_coding5'UTR0.022398None127151
GSE45833_6_altENSG00000158987.20ENST00000507093.5RAPGEF6protein_coding5'UTR0.022398None127151
GSE58207_altENSG00000158987.20ENST00000507093.5RAPGEF6protein_coding5'UTR0.0467473.011e-23127151
GSE94613_2ENSG00000158987.20ENST00000507093.5RAPGEF6protein_coding5'UTR0.003038None127151
GSE94613_2_altENSG00000158987.20ENST00000507093.5RAPGEF6protein_coding5'UTR0.003038None127151
SRR964946_altENSG00000158987.20ENST00000507093.5RAPGEF6protein_coding5'UTR0.0487480.000649127151
GSE45833_6ENSG00000158987.20ENST00000515170.5RAPGEF6protein_coding5'UTR0.022398None128152
GSE45833_6_altENSG00000158987.20ENST00000515170.5RAPGEF6protein_coding5'UTR0.022398None128152
GSE58207_altENSG00000158987.20ENST00000515170.5RAPGEF6protein_coding5'UTR0.0467471.433e-13128152
GSE94613_2ENSG00000158987.20ENST00000515170.5RAPGEF6protein_coding5'UTR0.003038None128152
GSE94613_2_altENSG00000158987.20ENST00000515170.5RAPGEF6protein_coding5'UTR0.003038None128152
SRR964946_altENSG00000158987.20ENST00000515170.5RAPGEF6protein_coding5'UTR0.0487480.000649128152
GSE45833_6ENSG00000158987.20ENST00000510071.5RAPGEF6protein_coding5'UTR0.022398None146170
GSE45833_6_altENSG00000158987.20ENST00000510071.5RAPGEF6protein_coding5'UTR0.022398None146170
GSE58207_altENSG00000158987.20ENST00000510071.5RAPGEF6protein_coding5'UTR0.0467471.433e-13146170
GSE94613_2ENSG00000158987.20ENST00000510071.5RAPGEF6protein_coding5'UTR0.003038None146170
GSE94613_2_altENSG00000158987.20ENST00000510071.5RAPGEF6protein_coding5'UTR0.003038None146170
SRR964946_altENSG00000158987.20ENST00000510071.5RAPGEF6protein_coding5'UTR0.0487480.006517146170
GSE45833_6ENSG00000158987.20ENST00000509018.5RAPGEF6protein_coding5'UTR0.022398None151175
GSE45833_6_altENSG00000158987.20ENST00000509018.5RAPGEF6protein_coding5'UTR0.022398None151175
GSE58207_altENSG00000158987.20ENST00000509018.5RAPGEF6protein_coding5'UTR0.0467473.011e-23151175
GSE94613_2ENSG00000158987.20ENST00000509018.5RAPGEF6protein_coding5'UTR0.003038None151175
GSE94613_2_altENSG00000158987.20ENST00000509018.5RAPGEF6protein_coding5'UTR0.003038None151175
SRR964946_altENSG00000158987.20ENST00000509018.5RAPGEF6protein_coding5'UTR0.0487480.000649151175
GSE45833_6ENSG00000158987.20ENST00000296859.10RAPGEF6protein_coding5'UTR0.022398None2650
GSE45833_6_altENSG00000158987.20ENST00000296859.10RAPGEF6protein_coding5'UTR0.022398None2650
GSE58207_altENSG00000158987.20ENST00000296859.10RAPGEF6protein_coding5'UTR0.0467473.011e-232650
GSE94613_2ENSG00000158987.20ENST00000296859.10RAPGEF6protein_coding5'UTR0.003038None2650
GSE94613_2_altENSG00000158987.20ENST00000296859.10RAPGEF6protein_coding5'UTR0.003038None2650
SRR964946_altENSG00000158987.20ENST00000296859.10RAPGEF6protein_coding5'UTR0.0487480.0006492650
GSE45833_6ENSG00000158987.20ENST00000627212.2RAPGEF6protein_coding5'UTR0.022398None7498
GSE45833_6_altENSG00000158987.20ENST00000627212.2RAPGEF6protein_coding5'UTR0.022398None7498
GSE58207_altENSG00000158987.20ENST00000627212.2RAPGEF6protein_coding5'UTR0.0467473.011e-237498
GSE94613_2ENSG00000158987.20ENST00000627212.2RAPGEF6protein_coding5'UTR0.003038None7498
GSE94613_2_altENSG00000158987.20ENST00000627212.2RAPGEF6protein_coding5'UTR0.003038None7498
SRR964946_altENSG00000158987.20ENST00000627212.2RAPGEF6protein_coding5'UTR0.0487480.0006497498
Min Ribo Pvalue0.003038
Min TIS Pvalue3.011e-23
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE45833_6BJ cellsTransformedGSM104759123594524;
GSE45833_6_altBJ cellsTransformedGSM104759123594524;
GSE58207_altHCT116colorectal carcinomaGSM1403307;GSM140330825510491;
GSE94613_2MOLM13acute myeloid leukemiaGSM248105329186125;
GSE94613_2_altMOLM13acute myeloid leukemiaGSM248105329186125;
SRR964946_altHEK293WTSRR96494622927429;

Database information
No results
Literature information
PMID26687005;
Cell lines Or TissuesBJ
PhenotypeNULL
Gene IDENSG00000158987
Transcript IDENST00000515170
SymbolNA
ORF TypesORF
Gene Typeprotein_coding
ThroughputHigh-throughput Literature Mining
InteractionNA
Function DescriptionNA
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
acute myeloid leukemiaPredictedByRibo
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID22927429
TitleGlobal mapping of translation initiation sites in mammalian cells at single-nucleotide resolution
JournalProc Natl Acad Sci U S A.2012 Sep 11;109(37):E2424-32.doi: 10.1073/pnas.1207846109.Epub 2012 Aug 27
AuthorsSooncheol Lee,Botao Liu,Soohyun Lee,Sheng-Xiong Huang,Ben Shen,Shu-Bing Qia
PMID23594524
Titlep53 induces transcriptional and translational programs to suppress cell proliferation and growth.
JournalGenome Biol. 2013 Apr 17;14(4):R32. doi: 10.1186/gb-2013-14-4-r32.
Authors"Loayza-Puch F, Drost J, Rooijers K, Lopes R, Elkon R, Agami R."
PMID23594524
Titlep53 induces transcriptional and translational programs to suppress cell proliferation and growth
JournalGenome Biol.2013 Apr 17;14(4):R32.doi: 10.1186/gb-2013-14-4-r32.
AuthorsFabricio Loayza-Puch,Jarno Drost,Koos Rooijers,Rui Lopes,Ran Elkon,Reuven Agam
PMID25510491
TitlePROTEOFORMER: deep proteome coverage through ribosome profiling and MS integration.
JournalNucleic Acids Res. 2015 Mar 11;43(5):e29. doi: 10.1093/nar/gku1283.
Authors"Crappe J, Ndah E, Koch A, Steyaert S, Gawron D, De Keulenaer S, De Meester E, De Meyer T, Van Criekinge W, Van Damme P, Menschaert G."
PMID25510491
TitlePROTEOFORMER: deep proteome coverage through ribosome profiling and MS integration
JournalNucleic Acids Res.2015 Mar 11;43(5):e29.doi: 10.1093/nar/gku1283.Epub 2014 Dec 15.
AuthorsJeroen Crappé,Elvis Ndah,Alexander Koch,Sandra Steyaert,Daria Gawron,Sarah De Keulenaer,Ellen De Meester,Tim De Meyer,Wim Van Criekinge,Petra Van Damme,Gerben Menschaert
PMID26687005
Title"Many lncRNAs, 5'UTRs, and pseudogenes are translated and some are likely to express functional proteins."
JournalElife. 2015 Dec 19;4:e08890. doi: 10.7554/eLife.08890.
Authors"Ji Z, Song R, Regev A, Struhl K."
PMID29186125
TitlePromoter-bound METTL3 maintains myeloid leukaemia by m 6 A-dependent translation control
JournalNature.2017 Dec 7;552(7683):126-131.doi: 10.1038/nature24678.Epub 2017 Nov 27.
AuthorsIsaia Barbieri,Konstantinos Tzelepis,Luca Pandolfini,Junwei Shi,Gonzalo Millán-Zambrano,Samuel C Robson,Demetrios Aspris,Valentina Migliori,Andrew J Bannister,Namshik Han,Etienne De Braekeleer,Hannes Ponstingl,Alan Hendrick,Christopher R Vakoc,George S Vassiliou,Tony Kouzarides