SmProt

Specific Information of Small Protein : SPROHSA137851

General Information

Small Protein ID	SPROHSA137851
Organism	Human (Homo sapiens)
Small Protein Sequence	MKVSAALLCLLLIAATFIPQGLAQPDAINAPVTCCYNFTNRKISVQRLASYRRITSSKCPKEAVM*
RNA Sequence	ATGAAAGTCTCTGCCGCCCTTCTGTGCCTGCTGCTCATAGCAGCCACCTTCATTCCCCAAGGGCTCGCTCAGCCAGATGCAATCAATGCCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAATCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATGTGA
Protein Length	65
Start Codon	ATG
Location	chr17:34255349-34256343:+
Blocks	34255349-34255425,34256221-34256343
Mean PhyloCSF	1.1777525207
Data Source	Ribosome profiling;
Related Genes	ENSG00000108691; CCL2;
Mass (Da)	mono. 7096.7; avg. 7101.4

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE114636_2_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.035913	0.003709	65	263	3	107.579630
SRR3208885	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.00336	None	65	263	10	9.07379482
GSE45833_5	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.0001	None	65	263	109	212.181802
GSE45833_5_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.0001	None	65	263	109	212.181802
GSE45785_2	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.000852	None	65	263	70	209.283660
GSE45785_2_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.000852	None	65	263	70	209.283660
GSE45785_1	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.001143	None	65	263	53	175.488925
GSE45833_1	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.002108	None	65	263	172	135.757820
GSE45785_3	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.039469	None	65	263	226	481.385508
SRR3317843	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	1.37E-06	None	65	263	186	790.552640
SRR3317843_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	1.37E-06	None	65	263	186	790.552640
GSE45833_4	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	1.919E-06	None	65	263	45	49.1044921
GSE45833_4_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	1.919E-06	None	65	263	45	49.1044921
GSE45833_2	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	2.564E-06	None	65	263	67	46.4670946
GSE45833_2_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	2.564E-06	None	65	263	67	46.4670946
SRR4045276	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	8.958E-19	None	65	263	350	418.658425
SRR4045276_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	8.958E-19	None	65	263	350	418.658425
GSE45833_6	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	9.642E-06	None	65	263	62	53.5056563
GSE45833_6_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	9.642E-06	None	65	263	62	53.5056563
GSE129869	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.001948	None	65	263	34	311.701848
GSE103308	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.00033	None	65	263	18	8.08648299
GSE103308_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.00033	None	65	263	18	8.08648299
GSE105082	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	2.594E-09	None	65	263	249	85.4583435
GSE105082_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	2.594E-09	None	65	263	249	85.4583435
GSE89183	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.027392	None	65	263	7	25.7880321
GSE89183_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.027392	None	65	263	7	25.7880321
SRR5047772	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.000164	None	65	263	150	133.956697
SRR5047770	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	2.503E-06	None	65	263	362	145.056314
SRR5047771	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	8.882E-10	None	65	263	194	44.8083214
SRR4045277	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	2.866E-08	None	65	263	46	704.404688
SRR4045277_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	2.866E-08	None	65	263	46	704.404688
SRR2991181	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.000323	None	65	263	104	85.8513594
SRR618770,618771,618772,618773_alt	ENSG00000108691.9	ENST00000580907.5	CCL2	Protein_coding	Annotated	0.011603	1.033E-05	65	263	4	3.41045253

Min Ribo P value	8.958E-19
Min TIS P value	1.033E-05

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE103308_alt	RD-muscle	WT	GSM2760247	29696588;
GSE103308	RD-muscle	WT	GSM2760247	29696588;
GSE105082_alt	HELA	Cervical cancer	GSM2817679; GSM2817680	30591072;
GSE105082	HELA	Cervical cancer	GSM2817679; GSM2817680	30591072;
GSE114636_2_alt	A549	Lung adenocarcinoma and infected with influenza virus	GSM3146277; GSM3146281	30673779;
GSE129869	Foreskin Fibroblasts	WT	GSM3723750; GSM3723751; GSM3723752	31167946;
GSE45785_1	BJ cells	WT	GSM1115204	23594524;
GSE45785_2_alt	BJ cells	Immortalized	GSM1115207	23594524;
GSE45785_2	BJ cells	Immortalized	GSM1115207	23594524;
GSE45785_3	BJ cells	Immortalized	GSM1115210	23594524;
GSE45833_1	BJ cells	Proliferation	GSM1047584; GSM1047585	23594524;
GSE45833_2_alt	BJ cells	Quiescence	GSM1047586; GSM1047587	23594524;
GSE45833_2	BJ cells	Quiescence	GSM1047586; GSM1047587	23594524;
GSE45833_4_alt	BJ cells	Proliferation	GSM1047589	23594524;
GSE45833_4	BJ cells	Proliferation	GSM1047589	23594524;
GSE45833_5_alt	BJ cells	Senescence	GSM1047590	23594524;
GSE45833_5	BJ cells	Senescence	GSM1047590	23594524;
GSE45833_6_alt	BJ cells	Transformed	GSM1047591	23594524;
GSE45833_6	BJ cells	Transformed	GSM1047591	23594524;
GSE89183_alt	CD34+ hematopoietic cells-Erythroid	WT	GSM2360179; GSM2360180	29551269;
GSE89183	CD34+ hematopoietic cells-Erythroid	WT	GSM2360179; GSM2360180	29551269;
SRR2991181	SH-SY5Y	Neuroblastoma	GSM1970518	31109297;
SRR3208885	ES cell-derived neurons TSC2+/+	WT	GSM2082537	27655340;
SRR3317843_alt	U2OS cells	WT	GSM2103080	27406171;
SRR3317843	U2OS cells	WT	GSM2103080	27406171;
SRR4045276_alt	Meg01 cells	WT	GSM2285909	27681415;
SRR4045276	Meg01 cells	WT	GSM2285909	27681415;
SRR4045277_alt	platelet-like particles	WT	GSM2285910	27681415;
SRR4045277	platelet-like particles	WT	GSM2285910	27681415;
SRR5047770	iPSC-differentiated dopamine neurons	Parkinson Disease	GSM2402496; GSM2402497; GSM2402498	NA;
SRR5047771	iPSC-differentiated dopamine neurons	Parkinson Disease	NA	NA;
SRR5047772	iPSC-differentiated dopamine neurons	Parkinson Disease	NA	NA;
SRR618770,618771,618772,618773_alt	HEK293	WT	SRR618770; SRR618771; SRR618772; SRR618773	NA;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO
Pfam	PF00048	Small cytokines (intecrine/chemokine), interleukin-8 like	33	64	2.7E-9	T	IPR001811	Chemokine interleukin-8-like domain	GO:0005576\|GO:0006955\|GO:0008009
PANTHER	PTHR12015:SF98		1	65	1.6E-37	T
PANTHER	PTHR12015		1	65	1.6E-37	T	IPR039809	Chemokine beta/gamma/delta	GO:0008009
SUPERFAMILY	SSF54117		26	64	3.41E-10	T	IPR036048	Chemokine interleukin-8-like superfamily	GO:0005576\|GO:0006955\|GO:0008009
Gene3D	G3DSA:2.40.50.40		24	65	3.8E-11	T

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
17-34255390-C-A	Non-Synonymous p.A14E	.	SRR6181538; SRR6181540
17-34256250-T-C	Synonymous p.C35C	rs4586	SRR3317843; SRR4045276; SRR4045277; SRR5047771; SRR5047772; SRR8310199; SRR6181538; SRR6181539; SRR6181540; SRR6181541

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results

a reliable repository with comprehensive annotation of small proteins derived from ribosome profiling