Specific Information of Small Protein : SPROHSA136202
General Information
Small Protein ID | SPROHSA136202 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MKKPRVQT* |
RNA Sequence | ATGAAAAAACCGAGGGTACAAACCTGA |
Protein Length | 8 |
Start Codon | ATG |
Location | chr1:214614838-214614865:+ |
Blocks | 214614838-214614865 |
Mean PhyloCSF | -8.29966656367 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000117724; CENPF; |
Mass (Da) | mono. 986.6; avg. 987.2 |
Ribosome profiling
Min Ribo P value | 0.028718 |
Min TIS P value | 0.011828 |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE81802_alt | CD19+ B cells | WT | GSM2175737 | 29529302; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |      |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |