Specific Information of Small Protein : SPROHSA136202
General Information
Small Protein IDSPROHSA136202
Organismhuman (Homo sapiens)
Small Protein SequenceMKKPRVQT*
RNA SequenceATGAAAAAACCGAGGGTACAAACCTGA
Protein Length8
Start CodonATG
Locationchr1:214614838-214614865:+
Blocks214614838-214614865
Mean PhyloCSF-8.29966656367
Data SourceRibosome profiling;
Related GenesENSG00000117724; CENPF;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE81802_altENSG00000117724.13ENST00000366955.8CENPFprotein_codingInternal0.0287180.01816337364
GSE81802_altENSG00000117724.13ENST00000464322.5CENPFprotein_codingNovel0.0287180.011828337364
Min Ribo Pvalue0.028718
Min TIS Pvalue0.011828
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE81802_altCD19+ B cellsWTGSM217573729529302;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID29529302
TitleTranslational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames
JournalNucleic Acids Res.2018 Apr 6;46(6):2802-2819.doi: 10.1093/nar/gky129.
AuthorsMaja Bencun,Olaf Klinke,Agnes Hotz-Wagenblatt,Severina Klaus,Ming-Han Tsai,Remy Poirey,Henri-Jacques Delecluse