Specific Information of Small Protein : SPROHSA136201
General Information
Small Protein ID | SPROHSA136201 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MKKIFLKLHILQEKNHKCFSVLPEYMI* |
RNA Sequence | ATGAAAAAAATTTTCTTAAAGCTGCATATACTCCAAGAAAAAAACCACAAATGTTTTTCTGTTTTGCCTGAATACATGATTTAA |
Protein Length | 27 |
Start Codon | ATG |
Location | chr22:50372046-50372130:+ |
Blocks | 50372046-50372130 |
Mean PhyloCSF | -8.08353573935 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000100239; PPP6R2; |
Mass (Da) | mono. 3329.8; avg. 3332.1 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE123564_1_alt | ENSG00000100239.16 | ENST00000395744.7 | PPP6R2 | Protein_coding | 5'UTR | 0.034381 | None | 247 | 331 | 9 | 21.3635706 |
GSE123564_1 | ENSG00000100239.16 | ENST00000395744.7 | PPP6R2 | Protein_coding | 5'UTR | 0.034381 | None | 247 | 331 | 9 | 21.3635706 |
GSE123564_1_alt | ENSG00000100239.16 | ENST00000612753.5 | PPP6R2 | Protein_coding | 5'UTR | 0.034381 | None | 251 | 335 | 9 | 21.3635706 |
GSE123564_1 | ENSG00000100239.16 | ENST00000612753.5 | PPP6R2 | Protein_coding | 5'UTR | 0.034381 | None | 251 | 335 | 9 | 21.3635706 |
GSE123564_1_alt | ENSG00000100239.16 | ENST00000395741.7 | PPP6R2 | Protein_coding | 5'UTR | 0.034381 | None | 255 | 339 | 9 | 21.3635706 |
GSE123564_1 | ENSG00000100239.16 | ENST00000395741.7 | PPP6R2 | Protein_coding | 5'UTR | 0.034381 | None | 255 | 339 | 9 | 21.3635706 |
GSE123564_1_alt | ENSG00000100239.16 | ENST00000359139.7 | PPP6R2 | Protein_coding | 5'UTR | 0.034381 | None | 274 | 358 | 9 | 21.3635706 |
GSE123564_1 | ENSG00000100239.16 | ENST00000359139.7 | PPP6R2 | Protein_coding | 5'UTR | 0.034381 | None | 274 | 358 | 9 | 21.3635706 |
Min Ribo P value | 0.034381 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE123564_1 | Skin fibroblasts | WT | GSM3507221; GSM3507222; GSM3507226; GSM3507227 | 30707697; |
GSE123564_1_alt | Skin fibroblasts | WT | GSM3507221; GSM3507222; GSM3507226; GSM3507227 | 30707697; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction | |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |