Specific Information of Small Protein : SPROHSA136201
General Information
Small Protein IDSPROHSA136201
Organismhuman (Homo sapiens)
Small Protein SequenceMKKIFLKLHILQEKNHKCFSVLPEYMI*
RNA SequenceATGAAAAAAATTTTCTTAAAGCTGCATATACTCCAAGAAAAAAACCACAAATGTTTTTCTGTTTTGCCTGAATACATGATTTAA
Protein Length27
Start CodonATG
Locationchr22:50372046-50372130:+
Blocks50372046-50372130
Mean PhyloCSF-8.08353573935
Data SourceRibosome profiling;
Related GenesENSG00000100239; PPP6R2;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE123564_1_altENSG00000100239.16ENST00000395744.7PPP6R2protein_coding5'UTR0.034381None247331
GSE123564_1ENSG00000100239.16ENST00000395744.7PPP6R2protein_coding5'UTR0.034381None247331
GSE123564_1_altENSG00000100239.16ENST00000612753.5PPP6R2protein_coding5'UTR0.034381None251335
GSE123564_1ENSG00000100239.16ENST00000612753.5PPP6R2protein_coding5'UTR0.034381None251335
GSE123564_1_altENSG00000100239.16ENST00000395741.7PPP6R2protein_coding5'UTR0.034381None255339
GSE123564_1ENSG00000100239.16ENST00000395741.7PPP6R2protein_coding5'UTR0.034381None255339
GSE123564_1_altENSG00000100239.16ENST00000359139.7PPP6R2protein_coding5'UTR0.034381None274358
GSE123564_1ENSG00000100239.16ENST00000359139.7PPP6R2protein_coding5'UTR0.034381None274358
Min Ribo Pvalue0.034381
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE123564_1Skin fibroblastsWTGSM3507221;GSM3507222;GSM3507226;GSM350722730707697;
GSE123564_1_altSkin fibroblastsWTGSM3507221;GSM3507222;GSM3507226;GSM350722730707697;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID30707697
TitleMammalian Hbs1L deficiency causes congenital anomalies and developmental delay associated with Pelota depletion and 80S monosome accumulation
JournalPLoS Genet.2019 Feb 1;15(2):e1007917.doi: 10.1371/journal.pgen.1007917.eCollection 2019 Feb.
AuthorsAmy E O'Connell,Maxim V Gerashchenko,Marie-Francoise O'Donohue,Samantha M Rosen,Eric Huntzinger,Diane Gleeson,Antonella Galli,Edward Ryder,Siqi Cao,Quinn Murphy,Shideh Kazerounian,Sarah U Morton,Klaus Schmitz-Abe,Vadim N Gladyshev,Pierre-Emmanuel Gleizes,Bertrand Séraphin,Pankaj B Agrawal