Specific Information of Small Protein : SPROHSA136200
General Information
Small Protein IDSPROHSA136200
Organismhuman (Homo sapiens)
Small Protein SequenceMKKMPLFSKSHKNPAEIVKILKDNLAILEKQDKKTDKASEEVSKSLQAMKEILCGTNEKEPPTEAVAQLAQELYSSGLLVTLIADLQLIDFEV
RNA SequenceATGAAAAAAATGCCTTTGTTTAGTAAATCACACAAAAATCCAGCAGAAATTGTGAAAATCCTGAAAGACAATTTGGCCATTTTGGAAAAGCAAGACAAAAAGACAGACAAGGCTTCAGAAGAAGTGTCTAAATCACTGCAAGCAATGAAAGAAATTCTGTGTGGTACAAACGAGAAAGAACCCCCAACAGAAGCAGTGGCTCAGCTAGCACAAGAACTCTACAGCAGTGGCCTGCTAGTGACACTGATAGCTGACCTGCAGCTGATAGACTTTGAGGTA
Protein Length93
Start CodonATG
Locationchr13:49376963-49382910:-
Blocks49376963-49377131,49382799-49382910
Mean PhyloCSF-7.54025807432
Data SourceRibosome profiling;
Related GenesENSG00000102547; CAB39L;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR5047771ENSG00000102547.19ENST00000409082.5CAB39Lprotein_codingAnnotated2.269e-09None188467
Min Ribo Pvalue2.269e-09
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
SRR5047771iPSC-differentiated dopamine neuronsParkinson DiseaseNANA;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
Gene3DG3DSA:1.25.10.104931.1E-24TIPR011989Armadillo-like helical
PANTHERPTHR101823931.5E-53TIPR013878Mo25-likeReactome: R-HSA-380972
SUPERFAMILYSSF4837112932.88E-20TIPR016024Armadillo-type fold
PANTHERPTHR10182:SF93931.5E-53T
PfamPF08569Mo25-like6924.7E-20TIPR013878Mo25-likeReactome: R-HSA-380972
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
References
No results