Specific Information of Small Protein : SPROHSA136194
General Information
Small Protein ID | SPROHSA136194 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MKKRREDFLLEMF* |
RNA Sequence | ATGAAAAAAAGGAGAGAGGACTTCCTGCTGGAGATGTTCTAG |
Protein Length | 13 |
Start Codon | ATG |
Location | chr18:35654765-35663633:+ |
Blocks | 35654765-35654801,35663627-35663633 |
Mean PhyloCSF | -6.24285711561 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000141429; GALNT1; |
Mass (Da) | mono. 1741.9; avg. 1743.1 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
GSE65778 | ENSG00000141429.13 | ENST00000591081.1 | GALNT1 | Protein_coding | Internal | 0.04011 | None | 194 | 236 | 6 | 25.0514538 |
GSE65778 | ENSG00000141429.13 | ENST00000269195.5 | GALNT1 | Protein_coding | Internal | 0.04011 | None | 206 | 248 | 6 | 25.0514538 |
GSE65778 | ENSG00000141429.13 | ENST00000589189.5 | GALNT1 | Protein_coding | Internal | 0.04011 | None | 262 | 304 | 6 | 25.0514538 |
GSE65778 | ENSG00000141429.13 | ENST00000591924.5 | GALNT1 | Protein_coding | Internal | 0.04011 | None | 329 | 371 | 6 | 25.0514538 |
Min Ribo P value | 0.04011 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE65778 | HEK293T | WT | GSM1606107; GSM1606108 | 25719440; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |