Specific Information of Small Protein : SPROHSA136193
General Information
Small Protein ID | SPROHSA136193 |
Organism | human (Homo sapiens) |
Small Protein Sequence | MKKRREDFLLEMRR* |
RNA Sequence | ATGAAAAAAAGGAGAGAGGACTTCCTGCTGGAGATGCGCAGGTAA |
Protein Length | 14 |
Start Codon | ATG |
Location | chr18:35654765-35659866:+ |
Blocks | 35654765-35654801,35659857-35659866 |
Mean PhyloCSF | -6.4240000089 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000141429; GALNT1; |
Ribosome profiling
RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
---|
GSE65778 | ENSG00000141429.13 | ENST00000590654.1 | GALNT1 | protein_coding | Internal | 0.040835 | None | 110 | 155 |
Min Ribo Pvalue | 0.040835 |
Min TIS Pvalue | None |
RiboID | CellORTissue | Phenotype | RiboSource | PMID |
---|
GSE65778 | HEK293T | WT | GSM1606107;GSM1606108 | 25719440; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
VarID | Consequence To sORF | rsID | RiboID |
---|
No results |
Related Small Proteins with Different TISs
ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |
References
PMID | 25719440 |
Title | The small molecule ISRIB reverses the effects of eIF2α phosphorylation on translation and stress granule assembly |
Journal | Elife.2015 Feb 26;4:e05033.doi: 10.7554/eLife.05033. |
Authors | Carmela Sidrauski,Anna M McGeachy,Nicholas T Ingolia,Peter Walter |