SmProt

Specific Information of Small Protein : SPROHSA136193

General Information

Small Protein ID	SPROHSA136193
Organism	Human (Homo sapiens)
Small Protein Sequence	MKKRREDFLLEMRR*
RNA Sequence	ATGAAAAAAAGGAGAGAGGACTTCCTGCTGGAGATGCGCAGGTAA
Protein Length	14
Start Codon	ATG
Location	chr18:35654765-35659866:+
Blocks	35654765-35654801,35659857-35659866
Mean PhyloCSF	-6.4240000089
Data Source	Ribosome profiling;
Related Genes	ENSG00000141429; GALNT1;
Mass (Da)	mono. 1907; avg. 1908.3

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE65778	ENSG00000141429.13	ENST00000590654.1	GALNT1	Protein_coding	Internal	0.040835	None	110	155	6	23.3813568

Min Ribo P value	0.040835
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE65778	HEK293T	WT	GSM1606107; GSM1606108	25719440;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results