Specific Information of Small Protein : SPROHSA136193
General Information
Small Protein IDSPROHSA136193
Organismhuman (Homo sapiens)
Small Protein SequenceMKKRREDFLLEMRR*
RNA SequenceATGAAAAAAAGGAGAGAGGACTTCCTGCTGGAGATGCGCAGGTAA
Protein Length14
Start CodonATG
Locationchr18:35654765-35659866:+
Blocks35654765-35654801,35659857-35659866
Mean PhyloCSF-6.4240000089
Data SourceRibosome profiling;
Related GenesENSG00000141429; GALNT1;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE65778ENSG00000141429.13ENST00000590654.1GALNT1protein_codingInternal0.040835None110155
Min Ribo Pvalue0.040835
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE65778HEK293TWTGSM1606107;GSM160610825719440;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID25719440
TitleThe small molecule ISRIB reverses the effects of eIF2α phosphorylation on translation and stress granule assembly
JournalElife.2015 Feb 26;4:e05033.doi: 10.7554/eLife.05033.
AuthorsCarmela Sidrauski,Anna M McGeachy,Nicholas T Ingolia,Peter Walter