Specific Information of Small Protein : SPROHSA136190
General Information
| Small Protein ID | SPROHSA136190 |
| Organism | Human (Homo sapiens) |
| Small Protein Sequence | MKKTHLGEKF* |
| RNA Sequence | ATGAAAAAAACGCACCTTGGAGAAAAATTTTAA |
| Protein Length | 10 |
| Start Codon | ATG |
| Location | chr11:93738116-93738149:- |
| Blocks | 93738116-93738149 |
| Mean PhyloCSF | -7.06584849502 |
| Data Source | Ribosome profiling; |
| Related Genes | ENSG00000166012; TAF1D; NONHSAG009374; |
| Mass (Da) | mono. 1217.7; avg. 1218.5 |
Ribosome profiling
| Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
|---|
| SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000448108.6 | TAF1D | Protein_coding | Internal | 0.026523 | 0.001726 | 1069 | 1102 | 7 | 35.8097515 |
| SRR964946_alt | ENSG00000166012.16 | ENST00000448108.6 | TAF1D | Protein_coding | Internal | 0.030242 | 0.030325 | 1069 | 1102 | NA | NA |
| SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000527068.1 | TAF1D | Protein_coding | Novel | 0.026523 | 0.000243 | 143 | 176 | 7 | 35.8097515 |
| SRR964946_alt | ENSG00000166012.16 | ENST00000527068.1 | TAF1D | Protein_coding | Novel | 0.030242 | 0.015833 | 143 | 176 | NA | NA |
| SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000532455.1 | TAF1D | Protein_coding | 3'UTR | 0.026523 | 0.007778 | 524 | 557 | 7 | 35.8097515 |
| SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000534770.1 | TAF1D | Protein_coding | 3'UTR | 0.026523 | 0.007778 | 545 | 578 | 7 | 35.8097515 |
| SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000527169.5 | TAF1D | Protein_coding | Internal | 0.026523 | 0.007778 | 603 | 636 | 7 | 35.8097515 |
| SRR964946_alt | ENSG00000166012.16 | ENST00000527169.5 | TAF1D | Protein_coding | Internal | 0.030242 | 0.030325 | 603 | 636 | NA | NA |
| SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000526015.5 | TAF1D | Protein_coding | Internal | 0.026523 | 0.001726 | 617 | 650 | 7 | 35.8097515 |
| SRR964946_alt | ENSG00000166012.16 | ENST00000526015.5 | TAF1D | Protein_coding | Internal | 0.030242 | 0.030325 | 617 | 650 | NA | NA |
| SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000323981.6 | TAF1D | Protein_coding | Internal | 0.026523 | 0.001726 | 618 | 651 | 7 | 35.8097515 |
| SRR964946_alt | ENSG00000166012.16 | ENST00000323981.6 | TAF1D | Protein_coding | Internal | 0.030242 | 0.030325 | 618 | 651 | NA | NA |
| Min Ribo P value | 0.026523 |
| Min TIS P value | 0.000243 |
| Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
|---|
| SRR618770,618771,618772,618773_alt | HEK293 | WT | SRR618770; SRR618771; SRR618772; SRR618773 | NA; |
| SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|
| No results |
| Disease | Detected |
|---|
| No results |
Related Variants
| Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
|---|
| No results |
Related Small Proteins with Different TISs
| SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|
| No results |
SmProt