Specific Information of Small Protein : SPROHSA136190
General Information
Small Protein ID | SPROHSA136190 |
Organism | human (Homo sapiens) |
Small Protein Sequence | MKKTHLGEKF* |
RNA Sequence | ATGAAAAAAACGCACCTTGGAGAAAAATTTTAA |
Protein Length | 10 |
Start Codon | ATG |
Location | chr11:93738116-93738149:- |
Blocks | 93738116-93738149 |
Mean PhyloCSF | -7.06584849502 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000166012; TAF1D; NONHSAG009374; |
Ribosome profiling
RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
---|
SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000448108.6 | TAF1D | protein_coding | Internal | 0.026523 | 0.001726 | 1069 | 1102 |
SRR964946_alt | ENSG00000166012.16 | ENST00000448108.6 | TAF1D | protein_coding | Internal | 0.030242 | 0.030325 | 1069 | 1102 |
SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000527068.1 | TAF1D | protein_coding | Novel | 0.026523 | 0.000243 | 143 | 176 |
SRR964946_alt | ENSG00000166012.16 | ENST00000527068.1 | TAF1D | protein_coding | Novel | 0.030242 | 0.015833 | 143 | 176 |
SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000532455.1 | TAF1D | protein_coding | 3'UTR | 0.026523 | 0.007778 | 524 | 557 |
SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000534770.1 | TAF1D | protein_coding | 3'UTR | 0.026523 | 0.007778 | 545 | 578 |
SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000527169.5 | TAF1D | protein_coding | Internal | 0.026523 | 0.007778 | 603 | 636 |
SRR964946_alt | ENSG00000166012.16 | ENST00000527169.5 | TAF1D | protein_coding | Internal | 0.030242 | 0.030325 | 603 | 636 |
SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000526015.5 | TAF1D | protein_coding | Internal | 0.026523 | 0.001726 | 617 | 650 |
SRR964946_alt | ENSG00000166012.16 | ENST00000526015.5 | TAF1D | protein_coding | Internal | 0.030242 | 0.030325 | 617 | 650 |
SRR618770,618771,618772,618773_alt | ENSG00000166012.16 | ENST00000323981.6 | TAF1D | protein_coding | Internal | 0.026523 | 0.001726 | 618 | 651 |
SRR964946_alt | ENSG00000166012.16 | ENST00000323981.6 | TAF1D | protein_coding | Internal | 0.030242 | 0.030325 | 618 | 651 |
Min Ribo Pvalue | 0.026523 |
Min TIS Pvalue | 0.000243 |
RiboID | CellORTissue | Phenotype | RiboSource | PMID |
---|
SRR618770,618771,618772,618773_alt | HEK293 | WT | SRR618770;SRR618771;SRR618772;SRR618773 | NA; |
SRR964946_alt | HEK293 | WT | SRR964946 | 22927429; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
VarID | Consequence To sORF | rsID | RiboID |
---|
No results |
Related Small Proteins with Different TISs
ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |
References
PMID | 22927429 |
Title | Global mapping of translation initiation sites in mammalian cells at single-nucleotide resolution |
Journal | Proc Natl Acad Sci U S A.2012 Sep 11;109(37):E2424-32.doi: 10.1073/pnas.1207846109.Epub 2012 Aug 27 |
Authors | Sooncheol Lee,Botao Liu,Soohyun Lee,Sheng-Xiong Huang,Ben Shen,Shu-Bing Qia |