Specific Information of Small Protein : SPROHSA136190
General Information
Small Protein IDSPROHSA136190
Organismhuman (Homo sapiens)
Small Protein SequenceMKKTHLGEKF*
RNA SequenceATGAAAAAAACGCACCTTGGAGAAAAATTTTAA
Protein Length10
Start CodonATG
Locationchr11:93738116-93738149:-
Blocks93738116-93738149
Mean PhyloCSF-7.06584849502
Data SourceRibosome profiling;
Related GenesENSG00000166012; TAF1D; NONHSAG009374;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR618770,618771,618772,618773_altENSG00000166012.16ENST00000448108.6TAF1Dprotein_codingInternal0.0265230.00172610691102
SRR964946_altENSG00000166012.16ENST00000448108.6TAF1Dprotein_codingInternal0.0302420.03032510691102
SRR618770,618771,618772,618773_altENSG00000166012.16ENST00000527068.1TAF1Dprotein_codingNovel0.0265230.000243143176
SRR964946_altENSG00000166012.16ENST00000527068.1TAF1Dprotein_codingNovel0.0302420.015833143176
SRR618770,618771,618772,618773_altENSG00000166012.16ENST00000532455.1TAF1Dprotein_coding3'UTR0.0265230.007778524557
SRR618770,618771,618772,618773_altENSG00000166012.16ENST00000534770.1TAF1Dprotein_coding3'UTR0.0265230.007778545578
SRR618770,618771,618772,618773_altENSG00000166012.16ENST00000527169.5TAF1Dprotein_codingInternal0.0265230.007778603636
SRR964946_altENSG00000166012.16ENST00000527169.5TAF1Dprotein_codingInternal0.0302420.030325603636
SRR618770,618771,618772,618773_altENSG00000166012.16ENST00000526015.5TAF1Dprotein_codingInternal0.0265230.001726617650
SRR964946_altENSG00000166012.16ENST00000526015.5TAF1Dprotein_codingInternal0.0302420.030325617650
SRR618770,618771,618772,618773_altENSG00000166012.16ENST00000323981.6TAF1Dprotein_codingInternal0.0265230.001726618651
SRR964946_altENSG00000166012.16ENST00000323981.6TAF1Dprotein_codingInternal0.0302420.030325618651
Min Ribo Pvalue0.026523
Min TIS Pvalue0.000243
RiboIDCellORTissuePhenotypeRiboSourcePMID
SRR618770,618771,618772,618773_altHEK293WTSRR618770;SRR618771;SRR618772;SRR618773NA;
SRR964946_altHEK293WTSRR96494622927429;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID22927429
TitleGlobal mapping of translation initiation sites in mammalian cells at single-nucleotide resolution
JournalProc Natl Acad Sci U S A.2012 Sep 11;109(37):E2424-32.doi: 10.1073/pnas.1207846109.Epub 2012 Aug 27
AuthorsSooncheol Lee,Botao Liu,Soohyun Lee,Sheng-Xiong Huang,Ben Shen,Shu-Bing Qia