Specific Information of Small Protein : SPROHSA136189
General Information
| Small Protein ID | SPROHSA136189 | ||
| Organism | human (Homo sapiens) | ||
| Small Protein Sequence | MKKTFLLTVNGNVSIHPTKSQL* | ||
| RNA Sequence | ATGAAAAAAACCTTCCTCTTGACGGTAAACGGCAACGTTTCCATTCACCCCACCAAGAGCCAACTGTAG | ||
| Protein Length | 22 | ||
| Start Codon | ATG | ||
| Location | chr5:79623262-79623331:+ | ||
| Blocks | 79623262-79623331 | ||
| Mean PhyloCSF | -7.08247825374 | ||
| Data Source | Ribosome profiling; | ||
| Related Genes | ENSG00000164329; TENT2; NONHSAG040825; | ||
Ribosome profiling
| RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
|---|---|---|---|---|---|---|---|---|---|
| GSE123564_2 | ENSG00000164329.13 | ENST00000505571.5 | TENT2 | protein_coding | Novel | 0.049432 | None | 395 | 464 |
| GSE123564_2_alt | ENSG00000164329.13 | ENST00000505571.5 | TENT2 | protein_coding | Novel | 0.049432 | None | 395 | 464 |
| GSE123564_2 | ENSG00000164329.13 | ENST00000296783.7 | TENT2 | protein_coding | Internal | 0.049432 | None | 537 | 606 |
| GSE123564_2_alt | ENSG00000164329.13 | ENST00000296783.7 | TENT2 | protein_coding | Internal | 0.049432 | None | 537 | 606 |
| GSE123564_2 | ENSG00000164329.13 | ENST00000423041.6 | TENT2 | protein_coding | Internal | 0.049432 | None | 643 | 712 |
| GSE123564_2_alt | ENSG00000164329.13 | ENST00000423041.6 | TENT2 | protein_coding | Internal | 0.049432 | None | 643 | 712 |
| GSE123564_2 | ENSG00000164329.13 | ENST00000428308.6 | TENT2 | protein_coding | Internal | 0.049432 | None | 680 | 749 |
| GSE123564_2_alt | ENSG00000164329.13 | ENST00000428308.6 | TENT2 | protein_coding | Internal | 0.049432 | None | 680 | 749 |
| GSE123564_2 | ENSG00000164329.13 | ENST00000504233.5 | TENT2 | protein_coding | Internal | 0.049432 | None | 916 | 985 |
| GSE123564_2_alt | ENSG00000164329.13 | ENST00000504233.5 | TENT2 | protein_coding | Internal | 0.049432 | None | 916 | 985 |
| GSE123564_2 | ENSG00000164329.13 | ENST00000453514.5 | TENT2 | protein_coding | Internal | 0.049432 | None | 931 | 1000 |
| GSE123564_2_alt | ENSG00000164329.13 | ENST00000453514.5 | TENT2 | protein_coding | Internal | 0.049432 | None | 931 | 1000 |
| Min Ribo Pvalue | 0.049432 |
| Min TIS Pvalue | None |
| RiboID | CellORTissue | Phenotype | RiboSource | PMID |
|---|---|---|---|---|
| GSE123564_2 | Skin fibroblasts: Hbs1L-deficient | facial dysmorphism, growth restriction and retinal deposits | GSM3507223;GSM3507224;GSM3507225;GSM3507228;GSM3507229;GSM3507230 | 30707697; |
| GSE123564_2_alt | Skin fibroblasts: Hbs1L-deficient | facial dysmorphism, growth restriction and retinal deposits | GSM3507223;GSM3507224;GSM3507225;GSM3507228;GSM3507229;GSM3507230 | 30707697; |
Database information
| No results |
Literature information
| No results |
Mass Spectrometry Information
| No results |
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|---|---|---|---|---|---|---|---|---|---|
| No results | ||||||||||
| Disease | Detected | |
|---|---|---|
| No results | ||
Related Variants
| VarID | Consequence To sORF | rsID | RiboID |
|---|---|---|---|
| No results | |||
Related Small Proteins with Different TISs
| ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|---|---|---|---|
| No results | ||||
References
| PMID | 30707697 |
| Title | Mammalian Hbs1L deficiency causes congenital anomalies and developmental delay associated with Pelota depletion and 80S monosome accumulation |
| Journal | PLoS Genet.2019 Feb 1;15(2):e1007917.doi: 10.1371/journal.pgen.1007917.eCollection 2019 Feb. |
| Authors | Amy E O'Connell,Maxim V Gerashchenko,Marie-Francoise O'Donohue,Samantha M Rosen,Eric Huntzinger,Diane Gleeson,Antonella Galli,Edward Ryder,Siqi Cao,Quinn Murphy,Shideh Kazerounian,Sarah U Morton,Klaus Schmitz-Abe,Vadim N Gladyshev,Pierre-Emmanuel Gleizes,Bertrand Séraphin,Pankaj B Agrawal |