Small Protein ID | SPROHSA136188 | ||
Organism | human (Homo sapiens) | ||
Small Protein Sequence | MKKTFLLTVNGNVSIHPT | ||
RNA Sequence | ATGAAAAAAACCTTCCTCTTGACGGTAAACGGCAACGTTTCCATTCACCCCACC | ||
Protein Length | 18 | ||
Start Codon | ATG | ||
Location | chr5:79623262-79623316:+ | ||
Blocks | 79623262-79623316 | ||
Mean PhyloCSF | -7.41533332401 | ||
Data Source | Ribosome profiling; | ||
Related Genes | ENSG00000164329; TENT2; NONHSAG040825; |
RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
---|---|---|---|---|---|---|---|---|---|
GSE123564_2 | ENSG00000164329.13 | ENST00000503620.1 | TENT2 | protein_coding | Novel | 0.047495 | None | 528 | 582 |
GSE123564_2_alt | ENSG00000164329.13 | ENST00000503620.1 | TENT2 | protein_coding | Novel | 0.047495 | None | 528 | 582 |
Min Ribo Pvalue | 0.047495 |
Min TIS Pvalue | None |
RiboID | CellORTissue | Phenotype | RiboSource | PMID |
---|---|---|---|---|
GSE123564_2 | Skin fibroblasts: Hbs1L-deficient | facial dysmorphism, growth restriction and retinal deposits | GSM3507223;GSM3507224;GSM3507225;GSM3507228;GSM3507229;GSM3507230 | 30707697; |
GSE123564_2_alt | Skin fibroblasts: Hbs1L-deficient | facial dysmorphism, growth restriction and retinal deposits | GSM3507223;GSM3507224;GSM3507225;GSM3507228;GSM3507229;GSM3507230 | 30707697; |
No results |
No results |
No results |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|---|---|---|---|---|---|---|---|---|---|
No results |
Disease | Detected | |
---|---|---|
No results |
VarID | Consequence To sORF | rsID | RiboID |
---|---|---|---|
No results |
ID | Small Protein Length | Start Codon | Strand | Blocks |
---|---|---|---|---|
No results |
PMID | 30707697 |
Title | Mammalian Hbs1L deficiency causes congenital anomalies and developmental delay associated with Pelota depletion and 80S monosome accumulation |
Journal | PLoS Genet.2019 Feb 1;15(2):e1007917.doi: 10.1371/journal.pgen.1007917.eCollection 2019 Feb. |
Authors | Amy E O'Connell,Maxim V Gerashchenko,Marie-Francoise O'Donohue,Samantha M Rosen,Eric Huntzinger,Diane Gleeson,Antonella Galli,Edward Ryder,Siqi Cao,Quinn Murphy,Shideh Kazerounian,Sarah U Morton,Klaus Schmitz-Abe,Vadim N Gladyshev,Pierre-Emmanuel Gleizes,Bertrand Séraphin,Pankaj B Agrawal |