SmProt

Specific Information of Small Protein : SPROHSA136188

General Information

Small Protein ID	SPROHSA136188
Organism	Human (Homo sapiens)
Small Protein Sequence	MKKTFLLTVNGNVSIHPT
RNA Sequence	ATGAAAAAAACCTTCCTCTTGACGGTAAACGGCAACGTTTCCATTCACCCCACC
Protein Length	18
Start Codon	ATG
Location	chr5:79623262-79623316:+
Blocks	79623262-79623316
Mean PhyloCSF	-7.41533332401
Data Source	Ribosome profiling;
Related Genes	ENSG00000164329; TENT2; NONHSAG040825;
Mass (Da)	mono. 1999.1; avg. 2000.4

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE123564_2	ENSG00000164329.13	ENST00000503620.1	TENT2	Protein_coding	Novel	0.047495	None	528	582	16	42.4756695
GSE123564_2_alt	ENSG00000164329.13	ENST00000503620.1	TENT2	Protein_coding	Novel	0.047495	None	528	582	16	42.4756695

Min Ribo P value	0.047495
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE123564_2	Skin fibroblasts: Hbs1L-deficient	Facial dysmorphism, growth restriction and retinal deposits	GSM3507223; GSM3507224; GSM3507225; GSM3507228; GSM3507229; GSM3507230	30707697;
GSE123564_2_alt	Skin fibroblasts: Hbs1L-deficient	Facial dysmorphism, growth restriction and retinal deposits	GSM3507223; GSM3507224; GSM3507225; GSM3507228; GSM3507229; GSM3507230	30707697;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
No results

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results