Specific Information of Small Protein : SPROHSA136187
General Information
Small Protein IDSPROHSA136187
Organismhuman (Homo sapiens)
Small Protein SequenceMKKTFLLTVNGNVSI
RNA SequenceATGAAAAAAACCTTCCTCTTGACGGTAAACGGCAACGTTTCCATT
Protein Length15
Start CodonATG
Locationchr5:79623262-79623307:+
Blocks79623262-79623307
Mean PhyloCSF-7.60799999237
Data SourceRibosome profiling;
Related GenesENSG00000164329; TENT2; NONHSAG040825;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
GSE123564_2ENSG00000164329.13ENST00000515807.5TENT2protein_codingNovel0.045695None529574
GSE123564_2_altENSG00000164329.13ENST00000515807.5TENT2protein_codingNovel0.045695None529574
Min Ribo Pvalue0.045695
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
GSE123564_2Skin fibroblasts: Hbs1L-deficientfacial dysmorphism, growth restriction and retinal depositsGSM3507223;GSM3507224;GSM3507225;GSM3507228;GSM3507229;GSM350723030707697;
GSE123564_2_altSkin fibroblasts: Hbs1L-deficientfacial dysmorphism, growth restriction and retinal depositsGSM3507223;GSM3507224;GSM3507225;GSM3507228;GSM3507229;GSM350723030707697;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID30707697
TitleMammalian Hbs1L deficiency causes congenital anomalies and developmental delay associated with Pelota depletion and 80S monosome accumulation
JournalPLoS Genet.2019 Feb 1;15(2):e1007917.doi: 10.1371/journal.pgen.1007917.eCollection 2019 Feb.
AuthorsAmy E O'Connell,Maxim V Gerashchenko,Marie-Francoise O'Donohue,Samantha M Rosen,Eric Huntzinger,Diane Gleeson,Antonella Galli,Edward Ryder,Siqi Cao,Quinn Murphy,Shideh Kazerounian,Sarah U Morton,Klaus Schmitz-Abe,Vadim N Gladyshev,Pierre-Emmanuel Gleizes,Bertrand Séraphin,Pankaj B Agrawal