Specific Information of Small Protein : SPROHSA136186
General Information
Small Protein IDSPROHSA136186
Organismhuman (Homo sapiens)
Small Protein SequenceMKKNVPLTKLSEVF*
RNA SequenceATGAAAAAAAATGTACCCTTGACCAAGCTTTCAGAGGTATTCTAG
Protein Length14
Start CodonATG
Locationchr18:265313-265358:-
Blocks265313-265358
Mean PhyloCSF-7.11204440859
Data SourceRibosome profiling;
Related GenesENSG00000079134; THOC1;
Ribosome profiling
RiboIDGeneIDTransIDSymbolGeneTypeTISTypeRiboPvalueTISPvalueStartOnTransStopOnTrans
SRR4045276ENSG00000079134.12ENST00000578224.5THOC1protein_codingNovel0.032065None133178
SRR4045276_altENSG00000079134.12ENST00000578224.5THOC1protein_codingNovel0.032065None133178
SRR4045276ENSG00000079134.12ENST00000579232.5THOC1protein_codingNovel0.032065None133178
SRR4045276_altENSG00000079134.12ENST00000579232.5THOC1protein_codingNovel0.032065None133178
SRR4045276ENSG00000079134.12ENST00000580870.5THOC1protein_codingNovel0.032065None133178
SRR4045276_altENSG00000079134.12ENST00000580870.5THOC1protein_codingNovel0.032065None133178
SRR4045276ENSG00000079134.12ENST00000616322.4THOC1protein_codingInternal0.032065None133178
SRR4045276_altENSG00000079134.12ENST00000616322.4THOC1protein_codingInternal0.032065None133178
SRR4045276ENSG00000079134.12ENST00000631280.2THOC1protein_codingInternal0.032065None133178
SRR4045276_altENSG00000079134.12ENST00000631280.2THOC1protein_codingInternal0.032065None133178
SRR5350744ENSG00000079134.12ENST00000580870.5THOC1protein_codingNovel0.035975None133178
SRR5350744_altENSG00000079134.12ENST00000580870.5THOC1protein_codingNovel0.035975None133178
SRR4045276ENSG00000079134.12ENST00000580038.5THOC1protein_codingInternal0.032065None136181
SRR4045276_altENSG00000079134.12ENST00000580038.5THOC1protein_codingInternal0.032065None136181
SRR4045276ENSG00000079134.12ENST00000582313.5THOC1protein_codingNovel0.032065None141186
SRR4045276_altENSG00000079134.12ENST00000582313.5THOC1protein_codingNovel0.032065None141186
SRR4045276ENSG00000079134.12ENST00000581116.1THOC1protein_codingInternal0.032065None159204
SRR4045276_altENSG00000079134.12ENST00000581116.1THOC1protein_codingInternal0.032065None159204
SRR4045276ENSG00000079134.12ENST00000261600.11THOC1protein_codingInternal0.032065None161206
SRR4045276_altENSG00000079134.12ENST00000261600.11THOC1protein_codingInternal0.032065None161206
SRR4045276ENSG00000079134.12ENST00000581269.5THOC1protein_codingInternal0.032065None164209
SRR4045276_altENSG00000079134.12ENST00000581269.5THOC1protein_codingInternal0.032065None164209
SRR4045276ENSG00000079134.12ENST00000580544.1THOC1protein_codingNovel0.032065None226271
SRR4045276_altENSG00000079134.12ENST00000580544.1THOC1protein_codingNovel0.032065None226271
SRR5350744ENSG00000079134.12ENST00000580544.1THOC1protein_codingNovel0.035975None226271
SRR5350744_altENSG00000079134.12ENST00000580544.1THOC1protein_codingNovel0.035975None226271
SRR4045276ENSG00000079134.12ENST00000621904.4THOC1protein_codingInternal0.032065None82127
SRR4045276_altENSG00000079134.12ENST00000621904.4THOC1protein_codingInternal0.032065None82127
Min Ribo Pvalue0.032065
Min TIS PvalueNone
RiboIDCellORTissuePhenotypeRiboSourcePMID
SRR4045276Meg01 cellsWTGSM228590927681415;
SRR4045276_altMeg01 cellsWTGSM228590927681415;
SRR5350744PC9NSCLCGSM253890328388414;
SRR5350744_altPC9NSCLCGSM253890328388414;

Database information
No results
Literature information
No results
Mass Spectrometry Information
No results
Function and Disease
Functional domain prediction Funtion   
AnalysisSignature AccessionSignature DescriptionStart locationStop locationScoreStatus of the matchInterPro accessionInterPro descriptionGOPathways
No results
DiseaseDetected
No results
Related Variants
VarIDConsequence To sORFrsIDRiboID
No results
Related Small Proteins with Different TISs
IDSmall Protein LengthStart CodonStrandBlocks
No results
References
PMID27681415
TitleDynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets
JournalCell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088.
AuthorsEric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia
PMID28388414
TitleTranscription Impacts the Efficiency of mRNA Translation via Co-transcriptional N6-adenosine Methylation
JournalCell.2017 Apr 6;169(2):326-337.e12.doi: 10.1016/j.cell.2017.03.031.
AuthorsBoris Slobodin,Ruiqi Han,Vittorio Calderone,Joachim A F Oude Vrielink,Fabricio Loayza-Puch,Ran Elkon,Reuven Agami