Specific Information of Small Protein : SPROHSA136186
General Information
Small Protein ID | SPROHSA136186 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | MKKNVPLTKLSEVF* |
RNA Sequence | ATGAAAAAAAATGTACCCTTGACCAAGCTTTCAGAGGTATTCTAG |
Protein Length | 14 |
Start Codon | ATG |
Location | chr18:265313-265358:- |
Blocks | 265313-265358 |
Mean PhyloCSF | -7.11204440859 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000079134; THOC1; |
Mass (Da) | mono. 1632.9; avg. 1634 |
Ribosome profiling
Ribo-seq ID | Ensembl Gene ID | Ensembl Transcript ID | Symbol | Gene Type | TIS Type | Ribo P value | TIS P value | Start On Trans | Stop On Trans | In-frame Count | Ribo-seq RPKM |
---|
SRR4045276 | ENSG00000079134.12 | ENST00000578224.5 | THOC1 | Protein_coding | Novel | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000578224.5 | THOC1 | Protein_coding | Novel | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000579232.5 | THOC1 | Protein_coding | Novel | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000579232.5 | THOC1 | Protein_coding | Novel | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | Protein_coding | Novel | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | Protein_coding | Novel | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000616322.4 | THOC1 | Protein_coding | Internal | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000616322.4 | THOC1 | Protein_coding | Internal | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000631280.2 | THOC1 | Protein_coding | Internal | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000631280.2 | THOC1 | Protein_coding | Internal | 0.032065 | None | 133 | 178 | 3 | 15.7894034 |
SRR5350744 | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | Protein_coding | Novel | 0.035975 | None | 133 | 178 | 4 | 34.5904003 |
SRR5350744_alt | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | Protein_coding | Novel | 0.035975 | None | 133 | 178 | 4 | 34.5904003 |
SRR4045276 | ENSG00000079134.12 | ENST00000580038.5 | THOC1 | Protein_coding | Internal | 0.032065 | None | 136 | 181 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000580038.5 | THOC1 | Protein_coding | Internal | 0.032065 | None | 136 | 181 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000582313.5 | THOC1 | Protein_coding | Novel | 0.032065 | None | 141 | 186 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000582313.5 | THOC1 | Protein_coding | Novel | 0.032065 | None | 141 | 186 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000581116.1 | THOC1 | Protein_coding | Internal | 0.032065 | None | 159 | 204 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000581116.1 | THOC1 | Protein_coding | Internal | 0.032065 | None | 159 | 204 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000261600.11 | THOC1 | Protein_coding | Internal | 0.032065 | None | 161 | 206 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000261600.11 | THOC1 | Protein_coding | Internal | 0.032065 | None | 161 | 206 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000581269.5 | THOC1 | Protein_coding | Internal | 0.032065 | None | 164 | 209 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000581269.5 | THOC1 | Protein_coding | Internal | 0.032065 | None | 164 | 209 | 3 | 15.7894034 |
SRR4045276 | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | Protein_coding | Novel | 0.032065 | None | 226 | 271 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | Protein_coding | Novel | 0.032065 | None | 226 | 271 | 3 | 15.7894034 |
SRR5350744 | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | Protein_coding | Novel | 0.035975 | None | 226 | 271 | 4 | 34.5904003 |
SRR5350744_alt | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | Protein_coding | Novel | 0.035975 | None | 226 | 271 | 4 | 34.5904003 |
SRR4045276 | ENSG00000079134.12 | ENST00000621904.4 | THOC1 | Protein_coding | Internal | 0.032065 | None | 82 | 127 | 3 | 15.7894034 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000621904.4 | THOC1 | Protein_coding | Internal | 0.032065 | None | 82 | 127 | 3 | 15.7894034 |
Min Ribo P value | 0.032065 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
SRR4045276 | Meg01 cells | WT | GSM2285909 | 27681415; |
SRR4045276_alt | Meg01 cells | WT | GSM2285909 | 27681415; |
SRR5350744 | PC9 | NSCLC | GSM2538903 | 28388414; |
SRR5350744_alt | PC9 | NSCLC | GSM2538903 | 28388414; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
No results |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |