Specific Information of Small Protein : SPROHSA136186
General Information
| Small Protein ID | SPROHSA136186 | ||
| Organism | human (Homo sapiens) | ||
| Small Protein Sequence | MKKNVPLTKLSEVF* | ||
| RNA Sequence | ATGAAAAAAAATGTACCCTTGACCAAGCTTTCAGAGGTATTCTAG | ||
| Protein Length | 14 | ||
| Start Codon | ATG | ||
| Location | chr18:265313-265358:- | ||
| Blocks | 265313-265358 | ||
| Mean PhyloCSF | -7.11204440859 | ||
| Data Source | Ribosome profiling; | ||
| Related Genes | ENSG00000079134; THOC1; | ||
Ribosome profiling
| RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
|---|---|---|---|---|---|---|---|---|---|
| SRR4045276 | ENSG00000079134.12 | ENST00000578224.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000578224.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
| SRR4045276 | ENSG00000079134.12 | ENST00000579232.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000579232.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
| SRR4045276 | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
| SRR4045276 | ENSG00000079134.12 | ENST00000616322.4 | THOC1 | protein_coding | Internal | 0.032065 | None | 133 | 178 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000616322.4 | THOC1 | protein_coding | Internal | 0.032065 | None | 133 | 178 |
| SRR4045276 | ENSG00000079134.12 | ENST00000631280.2 | THOC1 | protein_coding | Internal | 0.032065 | None | 133 | 178 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000631280.2 | THOC1 | protein_coding | Internal | 0.032065 | None | 133 | 178 |
| SRR5350744 | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | protein_coding | Novel | 0.035975 | None | 133 | 178 |
| SRR5350744_alt | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | protein_coding | Novel | 0.035975 | None | 133 | 178 |
| SRR4045276 | ENSG00000079134.12 | ENST00000580038.5 | THOC1 | protein_coding | Internal | 0.032065 | None | 136 | 181 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000580038.5 | THOC1 | protein_coding | Internal | 0.032065 | None | 136 | 181 |
| SRR4045276 | ENSG00000079134.12 | ENST00000582313.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 141 | 186 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000582313.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 141 | 186 |
| SRR4045276 | ENSG00000079134.12 | ENST00000581116.1 | THOC1 | protein_coding | Internal | 0.032065 | None | 159 | 204 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000581116.1 | THOC1 | protein_coding | Internal | 0.032065 | None | 159 | 204 |
| SRR4045276 | ENSG00000079134.12 | ENST00000261600.11 | THOC1 | protein_coding | Internal | 0.032065 | None | 161 | 206 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000261600.11 | THOC1 | protein_coding | Internal | 0.032065 | None | 161 | 206 |
| SRR4045276 | ENSG00000079134.12 | ENST00000581269.5 | THOC1 | protein_coding | Internal | 0.032065 | None | 164 | 209 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000581269.5 | THOC1 | protein_coding | Internal | 0.032065 | None | 164 | 209 |
| SRR4045276 | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | protein_coding | Novel | 0.032065 | None | 226 | 271 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | protein_coding | Novel | 0.032065 | None | 226 | 271 |
| SRR5350744 | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | protein_coding | Novel | 0.035975 | None | 226 | 271 |
| SRR5350744_alt | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | protein_coding | Novel | 0.035975 | None | 226 | 271 |
| SRR4045276 | ENSG00000079134.12 | ENST00000621904.4 | THOC1 | protein_coding | Internal | 0.032065 | None | 82 | 127 |
| SRR4045276_alt | ENSG00000079134.12 | ENST00000621904.4 | THOC1 | protein_coding | Internal | 0.032065 | None | 82 | 127 |
| Min Ribo Pvalue | 0.032065 |
| Min TIS Pvalue | None |
Database information
| No results |
Literature information
| No results |
Mass Spectrometry Information
| No results |
Function and Disease
| Functional domain prediction |  |
| Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
|---|---|---|---|---|---|---|---|---|---|---|
| No results | ||||||||||
| Disease | Detected | |
|---|---|---|
| No results | ||
Related Variants
| VarID | Consequence To sORF | rsID | RiboID |
|---|---|---|---|
| No results | |||
Related Small Proteins with Different TISs
| ID | Small Protein Length | Start Codon | Strand | Blocks |
|---|---|---|---|---|
| No results | ||||
References
| PMID | 27681415 |
| Title | Dynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets |
| Journal | Cell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088. |
| Authors | Eric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia |
| PMID | 28388414 |
| Title | Transcription Impacts the Efficiency of mRNA Translation via Co-transcriptional N6-adenosine Methylation |
| Journal | Cell.2017 Apr 6;169(2):326-337.e12.doi: 10.1016/j.cell.2017.03.031. |
| Authors | Boris Slobodin,Ruiqi Han,Vittorio Calderone,Joachim A F Oude Vrielink,Fabricio Loayza-Puch,Ran Elkon,Reuven Agami |