Small Protein ID | SPROHSA136186 | ||
Organism | human (Homo sapiens) | ||
Small Protein Sequence | MKKNVPLTKLSEVF* | ||
RNA Sequence | ATGAAAAAAAATGTACCCTTGACCAAGCTTTCAGAGGTATTCTAG | ||
Protein Length | 14 | ||
Start Codon | ATG | ||
Location | chr18:265313-265358:- | ||
Blocks | 265313-265358 | ||
Mean PhyloCSF | -7.11204440859 | ||
Data Source | Ribosome profiling; | ||
Related Genes | ENSG00000079134; THOC1; |
RiboID | GeneID | TransID | Symbol | GeneType | TISType | RiboPvalue | TISPvalue | StartOnTrans | StopOnTrans |
---|---|---|---|---|---|---|---|---|---|
SRR4045276 | ENSG00000079134.12 | ENST00000578224.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000578224.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
SRR4045276 | ENSG00000079134.12 | ENST00000579232.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000579232.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
SRR4045276 | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 133 | 178 |
SRR4045276 | ENSG00000079134.12 | ENST00000616322.4 | THOC1 | protein_coding | Internal | 0.032065 | None | 133 | 178 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000616322.4 | THOC1 | protein_coding | Internal | 0.032065 | None | 133 | 178 |
SRR4045276 | ENSG00000079134.12 | ENST00000631280.2 | THOC1 | protein_coding | Internal | 0.032065 | None | 133 | 178 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000631280.2 | THOC1 | protein_coding | Internal | 0.032065 | None | 133 | 178 |
SRR5350744 | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | protein_coding | Novel | 0.035975 | None | 133 | 178 |
SRR5350744_alt | ENSG00000079134.12 | ENST00000580870.5 | THOC1 | protein_coding | Novel | 0.035975 | None | 133 | 178 |
SRR4045276 | ENSG00000079134.12 | ENST00000580038.5 | THOC1 | protein_coding | Internal | 0.032065 | None | 136 | 181 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000580038.5 | THOC1 | protein_coding | Internal | 0.032065 | None | 136 | 181 |
SRR4045276 | ENSG00000079134.12 | ENST00000582313.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 141 | 186 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000582313.5 | THOC1 | protein_coding | Novel | 0.032065 | None | 141 | 186 |
SRR4045276 | ENSG00000079134.12 | ENST00000581116.1 | THOC1 | protein_coding | Internal | 0.032065 | None | 159 | 204 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000581116.1 | THOC1 | protein_coding | Internal | 0.032065 | None | 159 | 204 |
SRR4045276 | ENSG00000079134.12 | ENST00000261600.11 | THOC1 | protein_coding | Internal | 0.032065 | None | 161 | 206 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000261600.11 | THOC1 | protein_coding | Internal | 0.032065 | None | 161 | 206 |
SRR4045276 | ENSG00000079134.12 | ENST00000581269.5 | THOC1 | protein_coding | Internal | 0.032065 | None | 164 | 209 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000581269.5 | THOC1 | protein_coding | Internal | 0.032065 | None | 164 | 209 |
SRR4045276 | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | protein_coding | Novel | 0.032065 | None | 226 | 271 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | protein_coding | Novel | 0.032065 | None | 226 | 271 |
SRR5350744 | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | protein_coding | Novel | 0.035975 | None | 226 | 271 |
SRR5350744_alt | ENSG00000079134.12 | ENST00000580544.1 | THOC1 | protein_coding | Novel | 0.035975 | None | 226 | 271 |
SRR4045276 | ENSG00000079134.12 | ENST00000621904.4 | THOC1 | protein_coding | Internal | 0.032065 | None | 82 | 127 |
SRR4045276_alt | ENSG00000079134.12 | ENST00000621904.4 | THOC1 | protein_coding | Internal | 0.032065 | None | 82 | 127 |
Min Ribo Pvalue | 0.032065 |
Min TIS Pvalue | None |
No results |
No results |
No results |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|---|---|---|---|---|---|---|---|---|---|
No results |
Disease | Detected | |
---|---|---|
No results |
VarID | Consequence To sORF | rsID | RiboID |
---|---|---|---|
No results |
ID | Small Protein Length | Start Codon | Strand | Blocks |
---|---|---|---|---|
No results |
PMID | 27681415 |
Title | Dynamic Regulation of a Ribosome Rescue Pathway in Erythroid Cells and Platelets |
Journal | Cell Rep.2016 Sep 27;17(1):1-10.doi: 10.1016/j.celrep.2016.08.088. |
Authors | Eric W Mills,Jamie Wangen,Rachel Green,Nicholas T Ingolia |
PMID | 28388414 |
Title | Transcription Impacts the Efficiency of mRNA Translation via Co-transcriptional N6-adenosine Methylation |
Journal | Cell.2017 Apr 6;169(2):326-337.e12.doi: 10.1016/j.cell.2017.03.031. |
Authors | Boris Slobodin,Ruiqi Han,Vittorio Calderone,Joachim A F Oude Vrielink,Fabricio Loayza-Puch,Ran Elkon,Reuven Agami |