SmProt

Specific Information of Small Protein : SPROHSA123140

General Information

Small Protein ID	SPROHSA123140
Organism	Human (Homo sapiens)
Small Protein Sequence	IRSCCVRGGSGVPWLEVDLNGEASEDLLGSQRPDPPSPTSHSSVAS*
RNA Sequence	ATCCGGAGCTGCTGCGTTCGGGGCGGTTCGGGAGTCCCCTGGTTGGAAGTGGACCTGAATGGGGAGGCGTCTGAGGATCTCCTGGGCTCTCAGCGGCCCGACCCGCCTTCCCCCACCTCCCACAGCTCTGTAGCTTCCTAG
Protein Length	46
Start Codon	ATC
Location	chr19:43934937-43935078:-
Blocks	43934937-43935078
Mean PhyloCSF	-7.75441845765
Data Source	Ribosome profiling;
Related Genes	ENSG00000124459; ZNF45;
Mass (Da)	mono. 4748.3; avg. 4751.1

Ribosome profiling

Ribo-seq ID	Ensembl Gene ID	Ensembl Transcript ID	Symbol	Gene Type	TIS Type	Ribo P value	TIS P value	Start On Trans	Stop On Trans	In-frame Count	Ribo-seq RPKM
GSE123564_2_alt	ENSG00000124459.12	ENST00000269973.10	ZNF45	Protein_coding	5'UTR	0.034576	None	204	345	5	5.08352428

Min Ribo P value	0.034576
Min TIS P value	None

Ribo-seq ID	Cell or Tissue	Phenotype	Ribo-seq Source Details	PMID
GSE123564_2_alt	Skin fibroblasts: Hbs1L-deficient	Facial dysmorphism, growth restriction and retinal deposits	GSM3507223; GSM3507224; GSM3507225; GSM3507228; GSM3507229; GSM3507230	30707697;

Database information

No results

Literature information

No results

Mass Spectrometry Information

No results

Function and Disease

Functional domain prediction

Analysis	Signature Accession	Signature Description	Start location	Stop location	Score	Status of the match	InterPro accession	InterPro description	GO	Pathways
No results

Disease	Detected
No results

Related Variants

Variant ID	Consequence to sORF	rsID	Ribo-seq ID
19-43934947-T-G	Synonymous p.V44V	rs365769	SRR2818791; SRR2991181; SRR1795425; SRR1795426; SRR1795427

Related Small Proteins with Different TISs

SmProt ID	Small Protein Length	Start Codon	Strand	Blocks
No results