Specific Information of Small Protein : SPROHSA123140
General Information
Small Protein ID | SPROHSA123140 |
Organism | Human (Homo sapiens) |
Small Protein Sequence | IRSCCVRGGSGVPWLEVDLNGEASEDLLGSQRPDPPSPTSHSSVAS* |
RNA Sequence | ATCCGGAGCTGCTGCGTTCGGGGCGGTTCGGGAGTCCCCTGGTTGGAAGTGGACCTGAATGGGGAGGCGTCTGAGGATCTCCTGGGCTCTCAGCGGCCCGACCCGCCTTCCCCCACCTCCCACAGCTCTGTAGCTTCCTAG |
Protein Length | 46 |
Start Codon | ATC |
Location | chr19:43934937-43935078:- |
Blocks | 43934937-43935078 |
Mean PhyloCSF | -7.75441845765 |
Data Source | Ribosome profiling; |
Related Genes | ENSG00000124459; ZNF45; |
Mass (Da) | mono. 4748.3; avg. 4751.1 |
Ribosome profiling
Min Ribo P value | 0.034576 |
Min TIS P value | None |
Ribo-seq ID | Cell or Tissue | Phenotype | Ribo-seq Source Details | PMID |
---|
GSE123564_2_alt | Skin fibroblasts: Hbs1L-deficient | Facial dysmorphism, growth restriction and retinal deposits | GSM3507223; GSM3507224; GSM3507225; GSM3507228; GSM3507229; GSM3507230 | 30707697; |
Mass Spectrometry Information
Function and Disease
Functional domain prediction |       |
Analysis | Signature Accession | Signature Description | Start location | Stop location | Score | Status of the match | InterPro accession | InterPro description | GO | Pathways |
---|
No results |
Disease | Detected |
---|
No results |
Related Variants
Variant ID | Consequence to sORF | rsID | Ribo-seq ID |
---|
19-43934947-T-G | Synonymous p.V44V | rs365769 | SRR2818791; SRR2991181; SRR1795425; SRR1795426; SRR1795427 |
Related Small Proteins with Different TISs
SmProt ID | Small Protein Length | Start Codon | Strand | Blocks |
---|
No results |