Loading...

Detail Information of piRNA: piR-xtr-4084447

General Information
piRBase Id piR-xtr-4084447 Accession N/A
Organism X. tropicalis Number of methods 2
Sequence GTGCATTGTAGTTGCATTGCA Number of papers 2
Length 21 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
113 GSM475282 2 20022248 Y12 IP egg
124 GSM744254 1 21818339 small RNA gastrula ventral, 20-32nt
Location in xenTrov9
1 best hit(s) with 0 mismatch(es) in xenTrov9
No. Location Gene RepeatMaker
Location 1 9:9608387-9608408:+ srebf1 ENSXETT00000091953; srebf1 ENSXETT00000079250; srebf1 ENSXETT00000075777; srebf1 ENSXETT00000101894; srebf1 ENSXETT00000026547; srebf1 ENSXETT00000089563; srebf1 ENSXETT00000084201; srebf1 ENSXETT00000077166; xtr-mir-33a ENSXETT00000059302;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 21818339 Journal PLoS One. 2011;6(7):e22569.
Title Expression of transposable elements in neural tissues during Xenopus development.
Authors Faunes F, Sanchez N, Moreno M, Olivares GH, Lee-Liu D, Almonacid L, Slater AW, Norambuena T, Taft RJ, Mattick JS, Melo F, Larrain J.